1. An Overview of Similarity Query Processing 김종익 전북대학교 컴퓨터공학부

2. 2 Table of Contents 01. Applications of similarity query processing 02. Problem Formulation 03. string Decomposition 04. Similarity Function 05. A naïve approach 06. Overlap Similarity 07. Similarity Query Processing with Inverted lists 08. Similarity Function Revisited 09. Filter and Verification Framework 10. Prefix Filtering based Approach 11. Exploiting Document Frequency Ordering

3. 3 Some examples and figures in this presentation are taken from the following materials Marios Hadjieleftheriou and Chen Li, Efficient Approximate Search on String Collections (tutorial), ICDE 2009 and VLDB 2009 Chuan Xiao, Wei Wang, Xuemin Lin, Jeffrey Xu Yu, Efficient Similarity Joins for Near Duplicate Detection, WWW 2008 (slide) Jongik Kim and Hongrae Lee, Efficient Exact Similarity Searches using Multiple Token Orderings, ICDE 2012 (slide)

4. Applications of similarity query processing (1/8) 4 Actual queries gathered by Google Web Search

5. 5 Should be “Niels Bohr” Applications of similarity query processing (2/8) Data Integration and data cleaning R informix…… microsoft…… ……… ……… S infromix… … … mcrosoft… ……

6. 6 Applications of similarity query processing (3/8) Duplicate (Web) Documents Detection

7. 7 Applications of similarity query processing (4/8) Identify Spams SPAM TEMPLATE Sir/Madam, We happily announce to you the draw of the EURO MILLIONS SPANISH LOTTERY INTERNATIONAL WINNINGS PROGRAM PROMOTIONS held on the 27TH MARCH 2008 in SPAIN. Your company or your personal e-mail address attached to ticket number 653-908-321-675 with serial main number drew lucky star winning numbers which consequently won in the 2ND category, you have therefore been approved for a lump sum pay out of 960.000.00 Euros. (NINE HUNDRED AND SIXTY THOUSAND EUROS). CONGRATULATIONS!!! Sincerely yours,

8. 8 Applications of similarity query processing (5/8) Detect Plagiarism Q. What are the advantages of RAID5 over RAID4? A. 1. Several write requests could be processed in parallel, since the bottleneck of a unique check disk has been eliminated. 2. Read requests have a higher level of parallelism. Since the data is distributed over all disks, read requests involve all disks, whereas in systems with a dedicated check disk the check disk never participates in read. Q. What are the advantages of RAID5 over RAID4? A. 1. Several write requests could be processed in parallel, since the bottleneck of a single check disk has been eliminated. 2. Read requests have a higher level of parallelism on RAID5. Since the data is distributed over all disks, read requests involve all disks, whereas in systems with a check disk the check disk never participates in read.

9. Recommendation of friends in an SNS service 9 Applications of similarity query processing (6/8) Friends vector: 1 0 0 1 1 0 0 1 Friends vector: 1 0 0 1 1 1 0 1 Friends of a person can be representation of a binary vector

10. Read (a fragment of genome sequence) Alignment 10 Applications of similarity query processing (7/8) GCTGATGTGCCGCCTCACTCCGGTGG … CACTCCTGTGG CTCACTCCTGTGG GCTGATGTGCCACCTCA GATGTGCCACCTCACTC GTGCCGCCTCACTCCTG CTCCTGTGG Reference sequence Short reads

11. 11 Applications of similarity query processing (8/8) Supported by Oracle Text CREATE TABLE engdict(word VARCHAR(20), len INT); Create preferences for text indexing: begin ctx_ddl.create_preference('STEM_FUZZY_PREF', 'BASIC_WORDLIST'); ctx_ddl.set_attribute('STEM_FUZZY_PREF','FUZZY_MATCH','ENGLISH'); ctx_ddl.set_attribute('STEM_FUZZY_PREF','FUZZY_SCORE','0'); ctx_ddl.set_attribute('STEM_FUZZY_PREF','FUZZY_NUMRESULTS','5000'); ctx_ddl.set_attribute('STEM_FUZZY_PREF','SUBSTRING_INDEX','TRUE'); ctx_ddl.set_attribute('STEM_FUZZY_PREF','STEMMER','ENGLISH'); end; / CREATE INDEX fuzzy_stem_subst_idx ON engdict ( word ) INDEXTYPE IS ctxsys.context PARAMETERS ('Wordlist STEM_FUZZY_PREF'); Usage: SELECT * FROM engdict WHERE CONTAINS(word, 'fuzzy(universisty, 70, 6, weight)', 1) > 0; Limitation: cannot handle errors in the first letters: Katherine versus Catherine Query Relaxation

12. 12 Problem Formulation (1/2) Find strings similar to a given string

13. Similar to: a domain-specific function returns a similarity value between two strings Common similarity functions: Jaccard coefficient Cosine similarity Dice similarity Edit distance 13 Problem Formulation (2/2) Functions require set data

14. 14 String Decomposition Word tokens for long string (e.g. web page) x = “yes as soon as possible” y = “as soon as possible please” x = {A, B, C, D, E} y = {B, C, D, E, F} wordyesassoonas 1 possbileplease tokenABCDEF q-gram tokens for short string (e.g. keyword query) x = “universal” G(x, 2) = {un, ni, iv, ve, er, rs, sa, al} u n i v e r s a l

15. 15 Similarity Function Jaccard Similarity Cosine similarity Dice similarity x = {A, B, C, D, E} y = {B, C, D, E, F} Edit Distance ED(x, y) = minimum number of edit operations to change x to y (insertion, deletion, substitution) x: Tom Hanks y: Ton Hank ED(x, y) = 2

16. 16 A naïve approach Given a collection of strings C, a query string x, and a threshold t of a similarity function sim, 1. decompose each string in C and the query string into tokens. 2. output those string y ∈ C such that sim(x, y) ≥ t. Since C contains a lot of strings, this approach is obviously inefficient.

17. 17 Overlap Similarity (1/2) Given a similarity threshold t, Overlap Similarity

18. 18 Overlap Similarity (2/2) Given an edit distance d, u n i v e r s a l d edit operations could affect d x q grams or, d edit operations on x can mutate d x q grams of x x = “universal” and G(x, 2) = {un, ni, iv, ve, er, rs, sa, al} 2 edit operations on x mutate 2 x 2 q-grams Hence, y should contains at least |G(x, 2)| - 2 x 2 = 4 q-grams in G(x, 2)

19. 19 Similarity Query Processing with Inverted lists IDStringRecord (token set) 1area{, re, ea} 2artisan{, rt, ti, is, sa, an} 3artist{, rt, ti, is, st} 4tisk{ti, is, sk} ……… ar sk ea is sa rt st ti 123 4 1 2 2 23 3 234 re 1 Make Inverted Lists an 2 3 Query: “artist”  Overlap threshold: 4 Merge to count occurrences 1 2 3 4 2 4 5 2 Answers of the query 2: “artisan” 3: “artist” {,,,, } ar rt tiis st 4 ar

20. 20 12341234 1313 3737 32 Count threshold t≥ 3 minHeap 2 17 1: count 2 < t (X) 2: count 3 = t (O) … 1 12 33 2 2 Merge Algorithm – HeapMerge

21. 21 Similarity Function Revisited Given a query x with a similarity threshold t, FOR ALL y, To determine the overlap threshold, we need to know the size of y, which varies according to each string in a collection.

22. 22 Filter and Verification Framework Find those strings that shares at least α tokens with the query string, where α is an overlap lower bound. FILTER Verify each string found in filtering stage by directly applying a similarity function VERIFICATION Quickly generate initial candidates using a minimum constraint Refine candidates using α FILTER REFINEMENT

23. 23 Prefix Filtering based Approach Query x = “artist”  {ar, rt, ti, is, st} and overlap threshold α = 4 ar is rt st ti 123 2 23 3 234 3 Inverted lists for the query st rt 3 3 2 ar is ti 123 2 234 3 Sort the lists by their sizes Prefix Lists: the first |G(x, 2)| – α + 1 lists Suffix Lists: remaining α – 1 lists Filtering Phase (the prefix filtering) Merge the prefix lists to generate candidates Refinement Phase Search the suffix lists for each candidate A candidate searches each suffix list to identify if it is contained in the list Binary search is used because suffix lists are usually very long 2 3 1 2 candidates 234 34 5 4 4 Sort the tokens by their document frequencies Document frequency ordering

24. 24 Exploiting Document Frequency Ordering (1/2) General Goal: minimize the number of candidates initially generated by making use of the document frequency ordering rt st ti 23 3 234 ar is 123 2 3 4 st rt 3 3 2 ar is ti 123 2 234 34 Prefix Lists: the first |G(x, 2)| – α + 1 lists Query x = “artist”  {ar, rt, ti, is, st} and overlap threshold α = 4 Suffix Lists: remaining α – 1 lists Prefix Lists: the first |G(x, 2)| – α + 1 lists Suffix Lists: remaining α – 1 lists Sort the tokens by their document frequencies 2 3 4 candidates 12 3 We can reduce 1.time for merging short lists 2.number of candidates  time for verification candidates

25. 25 Query x = {w 1, w 2 } and overlap threshold α = 2 w 2 is the prefix list # of candidates is 5 w 2 is the prefix list # of candidates is 0 w 1 is the prefix list # of candidates is 0 Total number of candidates is 0 Partition Observation By partitioning a data set, we can artificially modify document frequencies of tokens in each partition. We evaluate a query in each partition and take the union of the results. We can reduce the number of candidates by utilizing different token orderings among partitions. Because partitions have different token orderings, we need to sort tokens in a query record in each partition. Exploiting Document Frequency Ordering (2/2)

26. Q&A