1. The Evolutionary Basis of Bioinformatics: An Introduction to Phylogenetics http://bioquest.org/bedrock > Sequence 1 GAGGTAGTAATTAGATCCGAAA… > Sequence 2 GAGGTAGTAATTAGATCTGAAA… > Sequence 3 GAGGTAGTAATTAGATCTGTCA…

2. What is phylogenetics? Phylogenetics is the study of evolutionary relationships among and within species. crocodiles birds lizards snakes rodents primates marsupials

3. What is phylogenetics? crocodiles birds lizards snakes rodents primates marsupials This is an example of a phylogenetic tree.

4. Forensics: Did a patient’s HIV infection result from an invasive dental procedure performed by an HIV+ dentist? Applications of phylogenetics Conservation: How much gene flow is there among local populations of island foxes off the coast of California? Medicine: What are the evolutionary relationships among the various prion-related diseases? To be continued…

5. Phylogenetic concepts: Interpreting a Phylogeny Sequence A Sequence B Sequence C Sequence D Sequence E Time Which sequence is most closely related to B? A, because B diverged from A more recently than from any other sequence. Physical position in tree is not meaningful! Only tree structure matters.

6. Phylogenetic concepts: Rooted and Unrooted Trees Time A B C D Root = A B C D X = ? A B C D ? ?? ?? X

7. Rooting and Tree Interpretation bacteria archaebacteria oak fruit fly chicken human bacteria archaea oak fruit fly chicken human bacteria archaebacteria oak fruit fly chicken human – bones – cell nuclei + cell nuclei + bones

8. Rooting Methods Outgroup root Add 2+ taxa whose branches contain tree’s new root trout eagle batmouse trout eagle bat mouse Must already know position of new tree’s root (often go from higher to lower taxonomic unit, e.g. family  genus) shark ray shark

9. How Many Trees? Unrooted treesRooted trees # sequences # pairwise distances# trees # branches /tree# trees # branches /tree 3 4 5 6 10 30 N (assuming bifurcation only)

10. How Many Trees? 2N - 2(2N - 3)! 2 N - 2 (N - 2)! 2N - 3(2N - 5)! 2 N - 3 (N - 3)! N (N - 1) 2 N 58 4.95  10 38 57 8.69  10 36 43530 1834,459,425172,027,0254510 9459105156 8105715105 6155364 433133 # branches /tree# trees # branches /tree# trees # pairwise distances # sequences Rooted treesUnrooted trees

11. Tree Types Root 50 million years sharks seahorses frogs owls crocodiles armadillos bats Evolutionary trees measure time. Root sharks seahorses frogs owls crocodiles armadillos bats 5% change Phylograms measure change.

12. Tree Properties Root Ultrametricity All tips are an equal distance from the root. X Y a b c d e a = b + c + d + e Root Additivity Distance between any two tips equals the total branch length between them. X Y a b c d e XY = a + b + c + d + e In simple scenarios, evolutionary trees are ultrametric and phylograms are additive.

13. Tree Building Exercise Ultrametricity All tips are an equal distance from the root. Root X Y a b c d e a = b + c + d + e Using the distance matrix given, construct an ultrametric tree.

14. Phylogenetic Methods Maximum likelihood Maximizes likelihood of observed data Many different procedures exist. Three of the most popular: Maximum parsimony Minimizes total evolutionary change Neighbor-joining Minimizes distance between nearest neighbors

15. Comparison of Methods Neighbor-joiningMaximum parsimonyMaximum likelihood Very fastSlowVery slow Easily trapped in local optima Assumptions fail when evolution is rapid Highly dependent on assumed evolution model Good for generating tentative tree, or choosing among multiple trees Best option when tractable (<30 taxa, strong conservation) Good for very small data sets and for testing trees built using other methods

16. Phylogenetic concepts: Homology and Homoplasy Hair?Wings? Bat Chimp Hawk bat chimp hawk + hair no hair no wings + wings Homology: identity due to shared ancestry (evolutionary signal) Homoplasy: identity despite separate ancestry (evolutionary noise)

17. Trees are hypotheses about evolutionary history So far, we’ve looked at understanding and formulating these hypotheses. Now, let’s turn our attention to testing them.

18. Tree Testing Let’s study the following four sequences: How can we explain the indicated character? P. A C A T A C G Q. G T A T A C G R. G C A C A T G S. G C A C A C A 1.Homology: Changed just once. 2.Homoplasy: Changed twice or more. P Q R S Homology more likely, but homoplasy still feasible.

19. Tree Testing Now let’s look at four other sequences: W. A C A T G T C A G A C G X. G T A T G T C A G A C G Y. G C A C A C T G A A T G Z. G C A C A C T G A A C A P Q R S Same two explanations possible. Any changes to their relative likelihood? Homology much more likely; homoplasy implausible.

20. Tree Testing Basic principle: Long branches  Strong evolutionary signal A B C D Short branches  Weak evolutionary signal A B C D Zero-length branches  NO evolutionary signal A B C D Tree-testing methods: Bootstrapping, Jackknifing, Split decomposition, …

21. Applications of phylogenetics 1. Forensics Did a patient’s HIV infection result from an invasive dental procedure performed by an HIV+ dentist?

22. Phylogenetic analysis

23. So what do the results mean? 2 of 3 patients closer to dentist than to local controls. Statistical significance? More powerful analyses? Do we have enough data to be confident in our conclusions? What additional data would help? If we determine that the dentist’s virus is linked to those of patients E and G, what are possible interpretations of this pattern? How could we test between them?

24. How much gene flow is there among local populations of island foxes off the coast of California? Applications of phylogenetics 2. Conservation

25. http://bioquest.org/bedrock/ Wayne, K. R, Morin, P.A. 2004 Conservation Genetics in the New Molecular Age, Frontiers in Ecology and the Environment. 2: 89-97. (ESA publication)

26. Applications of phylogenetics What are the evolutionary relationships among the various prion-related diseases? 3. Medicine

27. Linking Sequence and Structure Enolase