Download presentation
Presentation is loading. Please wait.
Published byNorman Skinner Modified over 10 years ago
1
Layout by orngjce223, CC-BY Custom BLAST Databases A Primer Shawn Houston houston@alaska.edu UAF Life Science Informatics
2
Layout by orngjce223, CC-BY Custom BLAST Databases Why? To limit your search domain To use your unique sequences Automate your blast searches Pipeline Workflow How? Linux It's what I do...
3
Layout by orngjce223, CC-BY Custom BLAST Databases What do I need? Input in either FASTA or ASN.1 format I will focus on FASTA NCBI Toolkit formatdb BLAST binary downloads include formatdb formatdb [-] [-B filename] [-F filename] [-L filename] [-T filename] [-V] [-a] [-b] [-e] [-i filename] [-l filename] [-n str] [-o] [-p F] [-s] [-t str] [-v N] DESCRIPTION formatdb must be used in order to format protein or nucleotide source databases before these databases can be searched by blastall, blastpgp or MegaBLAST. The source database may be in either FASTA or ASN.1 format. Although the FASTA format is most often used as input to formatdb, the use of ASN.1 is advantageous for those who are using ASN.1 as the common source for other formats such as the GenBank report. Once a source database file has been formatted by formatdb it is not needed by BLAST. Please note that if you are going to apply periodic updates to your BLAST databases using fmerge(1), you will need to keep the source database file.
4
Layout by orngjce223, CC-BY FASTA Format >This is an entry header atcgtcgattgatgtcgtgatcgtagtcgtagctga tgactgtatgctgcatgtgctaaaaacatgctagct Important Note NCBI only considers the first 32 characters in a FASTA header significant and NCBI provided tools will decide if a sequence is unique using only these.
5
Layout by orngjce223, CC-BY The FASTA Header >dbi|accnum| my header An NCBI Recognized Database ID gb GenBank gb|accession|locus EMBL Data Library emb|accession|locus DDBJ, DNA Database of Japan dbj|accession|locus NBRF PIR pir||entry Protein Research Foundation prf||name SWISS-PROT sp|accession|entry name Brookhaven Protein Data Bank pdb|entry|chain Patents pat|country|number GenInfo Backbone Id bbs|number General database identifier gnl|database|identifier NCBI Reference Sequence ref|accession|locus Local Sequence identifier lcl|identifier
6
Layout by orngjce223, CC-BY The FASTA Header 2 Do not leave any space between '>' and the NCBI Database ID gnl and lcl can be your friend fastacmd Retrieves sequences from a blast formated database in FASTA format by accession number Free form headers are allowed Do not forget the 32 character “limit” Some things will not work (fastacmd, etc)
7
Layout by orngjce223, CC-BY The FASTA Header 3 >gnl|mydb|seq0001| sequence 1 atcgtagctagtcgatgctgtagc Uses seq0001 as accession number Indexes in database name mydb >lcl|seq0001| sequence 1 atcgtagctagtcgatgctgtagc Uses seq0001 as accession number
8
Layout by orngjce223, CC-BY But... I use Windows! DOS file line endings CR/LF Apple CR or LF Linux (Unix) LF dos2unix, tr -d '\r' unixfile, perl -pi - e's/\r\n/\n/g yourfile, etc.
9
Layout by orngjce223, CC-BY Formatting Your Database Let us assume we have a text formated file containing FASTA format nucleotide sequences, myfile.fa Let us assume we have a command line, cygwin, Apple Terminal, Linux, HP-UX, … $ formatdb -pF -imyfile.fa What do I get? myfile.fa.nhr, myfile.fa.nin, myfile.fa.nsq
10
Layout by orngjce223, CC-BY Formatting Your Database 2 But I am not using accession numbers or database identifiers... $ formatdb -pF -oF -imyfile.fa This produces the same files that work in the same way, except... No internal accession index No internal database identifier
11
Layout by orngjce223, CC-BY Using Your New Database Copy or move myfile.fa.nhr, myfile.fa.nin, myfile.fa.nsq to their final resting place Let's use it! We need an input sequence or sequences, FASTA format, in one file, myseq.fa $ blastall -pblastn -imyseq.fa -d/mypath/myfile.fa -omyblast.out
12
Layout by orngjce223, CC-BY Let's Get Some Data You might have some data already, or NCBI http://www.ncbi.nlm.nih.gov/ http://www.ncbi.nlm.nih.gov/ Biomirror http://www.bio-mirror.net/ http://www.bio-mirror.net/ EMBL http://www.ebi.ac.uk/embl/ http://www.ebi.ac.uk/embl/ DDBJ http://www.ddbj.nig.ac.jp/ http://www.ddbj.nig.ac.jp/
13
Layout by orngjce223, CC-BY Let's Get Some Data 2 http://xml.nig.ac.jp/tutorial/rest/index.html#l2.1 http://xml.nig.ac.jp/tutorial/rest/index.html#l2.1 use LWP::UserAgent; $ua = new LWP::UserAgent; # make request $req = new HTTP::Request POST => 'http://xml.ddbj.nig.ac.jp/rest/Invoke'; $req->content_type('application/x-www-form-urlencoded'); # set parameters $req->content('service=GetEntry&method=getDDBJEntry&accession=AB000100'); # send request and get response. $res = $ua->request($req); # If you want to get a large result. It is better to write to a file directly. # $res = $ua->request($req,'file_name.txt'); # show response. print $res->content;http://xml.ddbj.nig.ac.jp/rest/Invoke
14
Layout by orngjce223, CC-BY Let's Get Some Data 3 ftp://ftp.ncbi.nih.gov/genbank/genomes/Fungi/ ftp://ftp.ncbi.nih.gov/genbank/genomes/Fungi/ Aspergillus_fumigatus Aspergillus_nidulans_FGSC_A4 Candida_albicans Candida_dubliniensis_CD36 Candida_glabrata_CBS138 Cryptococcus_neoformans_var_JEC21 Debaryomyces_hansenii_CBS767 ...
15
Layout by orngjce223, CC-BY Where To Go From Here $ man formatdb $ man blastall $ blastall - HTML Documentation But, I don't have NCBI Tools installed! Get your computer support people to do this if you can, otherwise you can download binaries from ftp://ftp.ncbi.nih.gov/blast/executables/release/2.2.23/
16
Layout by orngjce223, CC-BY Still Going... There are no instructions for installing NCBI binaries On Linux the BLAST data files go in /usr/share/ncbi/data There are a lot of BLAST programs blastall Blast megablast C++ Version (blastn, blastp, etc)
17
Layout by orngjce223, CC-BY Are We Done? Questions Comments Demo ftp://folders.inbre.alaska.edu/FMP/BLASTdbDemo/ ftp://folders.inbre.alaska.edu/FMP/BLASTdbDemo/ ftp://ftp.ncbi.nih.gov/blast/executables/release/2.2.23/ Conclusion(s) This is easy! (keep repeating until you believe) ???????
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.