2. Chapter 12

3. Genetic facts in 1900: Both female and male organisms have identical chromosomes except for one pair. Genes are located on chromosomes All organisms have two types of chromosomes: Sex chromosomes Autosomes

4. Male vs Female MALE Usually the Y chromosome. Y is usually smaller Male genotype = XY FEMALE Usually the X chromosome. Larger than the Y Female genotype XX Except Birds Male = XX Female = XY

5. Frederick Griffith British bacteriologist 1928 = designed and performed experiment on rats and bacteria that causes pneumonia. 2 strains of the bacteria Type S = causes severe pneumonia Type R = relatively harmless

6. Griffith’s Rats 1. First he injected living Type S bacteria into rats:

7. Second he injected dead Type S into the rats.

8. Next he injected living type R bacteria

9. Finally he injected a mixture of living Type R and dead Type S :

10. Results of experiments: Because the dead rat tissue showed living Type S bacteria, something “brought the Type S back to life” Actually one bacterial type incorporated the DNA, or instructions, from the dead bacteria into its own DNA Known as transformation. Confirmed by Avery, MacLeod, and McCarty in 1944

11. Oswald Avery Canadian biologist (1877- 1955) Discovered DNA in 1944 with a team of scientists.

12. Hershey and Chase 1952 Attempted to solve the debate on whether DNA or proteins are responsible for providing the genetic material.

13. They used a bacteriophage (a virus which attacks bacteria) to prove that DNA was definitely the genetic material.

15. Phoebus A. Levene Russian born; immigrated to America, moves to Europe. 1920’s discovered nucleotides (building blocks of DNA) 1. Sugar 2. Phosphate group 3. Nitrogenous base

16. Composition of DNA

17. Components and structure of DNA A very long molecule. 4 nitrogenous bases:

18. Chargaff’s rules The relative amounts of adenine and thymine are the same in DNA The relative amounts of cytosine and guanine are the same. Named after Erwin Chargaff

19. Rosalind Franklin Used X-Ray diffraction to get information about the structure of DNA:

20. Structure of DNA Discovered in 1953 by two scientists: James Watson (USA) Francis Crick (GBR) Known as the double-helix model.

22. The double-helix A twisted ladder with two long chains of alternating phosphates and sugars. The nitrogenous bases act as the “rungs” joining the two strands.

23. How long is the DNA molecule?

24. Chromosomes & DNA replication The nucleus of one human cell contains approximately 1 meter of DNA. Histones = DNA tightly wrapped around a protein Nucleosome:

25. Chromosome structure:

26. DNA replication Must occur before a cell divides. Each new cell needs a copy of the information in order to grow.

27. DNA replication. Why needed? Before DNA strand can be replicated or copied it must be “unzipped” DNA polymerase (enzyme that unzips) Starts at many different points. Why?

28. Completing the replication After the DNA molecule comes apart, bases of free nucleotides in the nucleus join their complimentary bases.

29. RNA Very similar to DNA. Exceptions: 1) Ribose is the 5-carbon sugar 2) Uracil replaces thymine 3) Single-stranded

30. mRNA (messenger) Copies genetic code of DNA by matching bases. Occurs in the nucleus. DNA changing to RNA

31. TRANSCRIPTION DNA is copied into mRNA with the aid of RNA polymerase. The RNA polymerase will bind to promoters that act as signals in the DNA sequence to make RNA.

32. Transcription continued:

33. Exons and Introns EXONS A segment of DNA in eukaryotic organisms that codes for a specific amino acid INTRONS A segment of DNA that does NOT code for an amino acid.

34. Confusing genetic terms: Polypeptide = a chain of amino acids. Protein = a complex structure composed of polypeptides Amino acids = smallest structural unit of a polypeptide. Gene = a distinct unit of material found on a chromosome

35. Reading the genetic code The genetic code is responsible for building all the proteins in the body using 20 different amino acids. How many 3 letter words can you make from the letters A,T,G and C? Answer: 64

36. Codons A three letter “word” that specifies an amino acid.

37. Genetic code:

38. tRNA (transfer) approx. 80 nucleotides in length. Cross-like shape At one end an amino acid is attached At the other end there is an anticodon Acts like a truck

39. Polypeptide assembly Translation = reading or “translating” the RNA code to form a chain of amino acids. Known as protein synthesis Occurs in the cytoplasm. (p.304)

40. Mutations The source of variation in a genetic sequence. Can be either gene or chromosomal mutations. Point mutations = a change in a single nucleotide in a sequence of DNA.

41. Frameshift Mutation Inserting an extra nucleotide which, in turn, shifts the entire sequence one way or the other.

42. Chromosomal mutations Involves a change in the number or structure of the chromosomes. Deletion : when a piece of a chromosome breaks off and is lost. Duplication : when a segment of a chromosome is repeated Inversion : when a segment of a chromosome is reversed.

43. More chromosomal mutations Translocation : when part of a chromosome breaks off and is attached to a non- homologous chromosome.

44. Control of gene expression Genes are often like light switches that can be turned off and on. Operon = occur in prokaryotes. (bacteria) different genes that work together to activate gene functions

45. Eukaryotic gene expression Controlled by complex sequences of DNA. Example: “TATA box”

46. Factors: Overall gene control is more difficult for eukaryotes because functional genes may be on different chromosomes. Environmental such as chemicals and temperature.

47. Hox and Oncogenes Hox genes Genes that actively control embryonic development. Oncogenes Genes known to cause cancer. Usually these are switched “off”, but can be switched “on” by a number of factors.

48. Assignment: Pages 315-116 1-10, 13, 15, 19, 20, 23 Transcribe this DNA sequence into RNA, then translate the RNA into an amino acid chain: TAGCCGACAGGCCTCTTTACT 1-12 page 317