Download presentation
Presentation is loading. Please wait.
Published byAlonzo Dax Modified over 10 years ago
2
Protein Synthesis DNA’s destiny!
3
Protein Review Long chains (POLYPEPTIDES) formed by 20 different amino acidsLong chains (POLYPEPTIDES) formed by 20 different amino acids Protein shape is determined by DNA sequence!Protein shape is determined by DNA sequence! SO HOW DO WE GO FROM DNA TO PROTEIN?? POLYPEPTIDE MADE OF MANY AMINO ACIDS
4
What does DNA really do? The genes in DNA must code for something right??? So what IS IT????The genes in DNA must code for something right??? So what IS IT???? The DNA alphabet (A, T, C, G) essentially codes for amino acidsThe DNA alphabet (A, T, C, G) essentially codes for amino acids –Which are the building blocks for……. PROTEINS!!!!!!!!!!
5
What does DNA do?? Con’t…… The order of bases in DNA contains a code for a SPECIFIC order of amino acidsThe order of bases in DNA contains a code for a SPECIFIC order of amino acids The order of amino acids determines the shape and function of the proteinThe order of amino acids determines the shape and function of the protein
6
DNA to Protein overview DNA mRNA Ribosome “reads” mRNA tRNA brings proper AMINO ACIDS to ribosome as mRNA is read Amino acids are linked together to make PROTEIN that gene coded for TAKES PLACE IN NUCLEUS TAKES PLACE IN CYTOPLASM
7
DNA to Protein Overview: The 2 phases PHASE 1: In the NUCLEUSPHASE 1: In the NUCLEUS –Called TRANSCRIPTION –“Transcribing” DNA to single strand of mRNA –This creates a “readable” message for ribosomes PHASE 2: In the CYTOPLASM PHASE 2: In the CYTOPLASM –Called TRANSLATION –Ribosomes “translate” the message found on the mRNA strand into amino acids –The amino acids are strung together to make the protein the gene coded for
8
DNA to PROTEIN http://www.you tube.com/watc h?v=983lhh20r GY http://www.you tube.com/watc h?v=983lhh20r GY
9
RNA Basics RNA is single strandedRNA is single stranded Contains U (uracil) instead of T (thymine)Contains U (uracil) instead of T (thymine) –So A binds with U in RNA Types of RNA:Types of RNA: –mRNA Messenger RNAMessenger RNA Result of transcriptionResult of transcription Contains a message from DNAContains a message from DNA –tRNA Transfer RNATransfer RNA Brings proper amino acid to ribosome during translationBrings proper amino acid to ribosome during translation
10
Phase 1: Transcription- Making mRNA Occurs INSIDE THE NUCLEUS 1.DNA strands separate at the bases 2.Complimentary RNA bases take their places along one of the DNA strands with the help of enzymes –Remember…..RNA bases are A, C, G, and U (uracil) –U instead of T! –This creates an mRNA strand Let’s see this in action! Let’s see this in action!
11
Phase 1: Transcription con’t… Let’s practice making mRNA from a DNA strand! T A C T T A G A T A U G A A U C U A DNAStrands A T G A A T C T A mRNAStrand mRNA leaves nucleus and attaches to a ribosome in the cytoplasm DNA IS UNZIPPED mRNA is constructed using ONE strand of DNA. mRNA pairs U with A, instead of T.
12
Diagram of Transcription
13
Phase 2: Translation- Making a Protein Occurs in the CYTOPLASM at a RIBOSOME 1.mRNA from transcription leaves the nucleus 2.mRNA attaches to a ribosome 3.Ribosome “reads” the message in the mRNA Ribosomes can only read 3 bases at a time!!!Ribosomes can only read 3 bases at a time!!! 3 mRNA bases is called a CODON.3 mRNA bases is called a CODON.
14
Translation con’t…. 4.Reading mRNA by ribosome signals a tRNA to bring the correct amino acid A codon codes for 1 amino acid (LOOK AT YOUR CODON SHEET)A codon codes for 1 amino acid (LOOK AT YOUR CODON SHEET) Ex. AUG codes for tRNA to bring MethionineEx. AUG codes for tRNA to bring Methionine 5.tRNA drops off amino acid at the ribosome
15
Translation con’t…. 6.Ribosome “reads” the next codon to signal for the next amino acid 7.Amino acids are connected by BONDS as they are brought by tRNA 8.The last codon read is a STOP codon that means the protein is complete!
16
Translation Diagram Forming Polypeptide Ribosome mRNA
17
Close up of translation
18
Let’s practice Translation! The strand we made earlier is:The strand we made earlier is: If 3 bases code for 1 amino acid, how many amino acids are coded for in our strand?If 3 bases code for 1 amino acid, how many amino acids are coded for in our strand? 3 of course! Using your CODON SHEET, translate the mRNA codons into 3 amino acidsUsing your CODON SHEET, translate the mRNA codons into 3 amino acids A U G A A U C U A
19
Translation Example A U G A A U C U A Ribosome tRNA brings Ribosome tRNA brings Methionine Asparagine Leucine Peptide Bond mRNAStrand
20
Let’s do the whole thing together! DNA strand:DNA strand:TACAAACATGGCTGATCGATT mRNA strandmRNA strandAUG|UUU|GUA|CCG|ACU|AGC|UAA Amino AcidsAmino AcidsMET-PHE-VAL-PRO-THR-SER-STOP
21
Protein Synthesis Overview
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.