1. Protein Synthesis: lab (pg 39-40)
L Explain the basic processes of transcription and translation, and how they result in the expression of genes.
EQ: Why is the sequence of nucleotides in DNA so important?

2. Bring it all together: Protein Synthesis
Protein synthesis involves transcription and translation
Step 1: Transcription (DNA to mRNA)
In the nucleus
T A, A  U, C - G
Step 2: Translation (mRNA to protein)
In the ribosomes
Reads mRNA Codons
How many nucleotides code for an amino acid?
3 nucleotides = 1 codon = 1 amino acid
More than 1 codon can code for the same amino acid

3. Genes Genes is a segment of our DNA code for building proteins
Transcription & Translation
Proteins create traits
DNA
TACGCACATTTACGTACGCGG
mRNA
AUGCGUGUAAAUGCAUGCGCC aa
protein
trait

4. The Genetic Code – universal!
Genetic code is universal – all organisms have the same 4 nucleotides
Proteins are the physical traits (expression of our genes)
Proteins synthesis is the SAME for all living organisms.
Strong evidence for a single origin in evolutionary theory.

5. What if something goes wrong??

6. Mutations Mutations are changes in DNA sequences
changes to the order of nucleotides (A, T, C & G)
different order = different amino acid
different protein structure = different protein function

7. What Causes Mutations? Mutations can be inherited. Parent to child
Mutations can be acquired.
Mutagens = environmental factors that can change DNA
Ex: UV light, radiation such as X-rays, chemicals in food, water, air, buildings

8. Types of Gene Mutations:
Changes in DNA that affect genetic information
Typically occur during replication
Frameshift mutation: the insertion or deletion of a nucleotide in the DNA sequence
Point mutation: one nucleotide is substituted for another

9. Gene Mutation

10. Potential Impact to Physical trait:
Some mutations are harmful
Reduce organism’s survival
Some mutations are beneficial
Improve organism’s survival
Most mutations are neutral
No advantage or disadvantage
Silent mutations- no effect on physical traits

11. How are mutations related to protein synthesis?
Changes in the DNA can cause a change in the protein

12. 1. A codon chart is shown to the right.
Which of these changes to the DNA triplet 3’ GCT 5’ will affect the protein produced?
GTT
TCC
TCT
GCA

13. Lab Instructions Where are the ribosomes? What do you do there?
Read the pink lab instructions
What are you doing in the nucleus?
How many people from each group?
Where are the ribosomes? What do you do there?
How will you know you are doing it right?
How do you find your Amino Acid chain?
How long will you have?
Be prepared to be called on with the
popsicle sticks!

14. Protein Synthesis Activity
Read through the procedures. What is occurring at each step?
Nucleus (back table)
Copy the DNA template A onto your lab sheet THEN Transcribe the DNA template onto your lab sheet
Ribosome (original table)
Other team members copy the DNA and mRNA (check for accuracy)
mRNA/Codon
Send one person to locate the correct codon and write the WORD on the back of the card onto your lab sheet.
Return to your group and report your findings
Protein Sentence
Get your sentence checked- it should start with ‘start’ and end with ‘stop’
Genetic Code
Use the codon chart to translate your mRNA to the appropriate amino acid

15. Protein Synthesis Lab C- level 2 voice H- ask three before me
A- In groups of 3, complete the process of protein synthesis moving from nucleus to ribosome.
M- remain at your ribosome (table) unless you are the mRNA transcribing the DNA in the nucleus.
P- complete 3 complete protein synthesis sentences on your lab sheet. Once you finish the three, work on analysis questions.
Success

16. Quiz next class on PS- study guide on the website!
Exit ticket!!
Quiz next class on PS- study guide on the website!

17. 1. The table shows a DNA sequence and three types of mutations that can change the DNA sequence.
Which mutation will cause translation to stop?
Mutations 1 and 3 only
Mutation 1 only
Mutation 2 only
Mutations 1, 2, and 3

18. During replication, mutations in DNA occurred
During replication, mutations in DNA occurred. The strands below show the original and mutated sequences. Original - ATC GCC GAT TCC AAA TGC CCG GTA CGA AAT AAG ACA Mutated - ATC GCC GAT TCC ATA TGC CCG GTA CGA AGT AAG ACA In the cell, DNA is transcribed into RNA. RNA is then translated into protein. The chart below shows the triplet RNA codons.
What are the new amino acids due to the genetic mutations?
A. Serine, alanine
B. tyrosine, serine
C. tyrosine, alanine
D. phenylalanine, asparagine

19. 3. The sequence of DNA below is part of a gene
3. The sequence of DNA below is part of a gene. How many amino acids are coded for by this segment?
5' ATCAGCGCTGGC 3' 4 8 12 24