1. Major differences between the basic genetic mechanisms in prokaryotes and eukaryotes
Prokaryotes Eukaryotes
DNA, RNA and protein synthesis DNA and RNA synthesis occur in
occur in the same compartment. the nucleus. Protein synthesis
mRNA is translated simultaneous occurs in the cytoplasm. mRNA
with its synthesis. Must be transported out of the nucleus
Only one RNA polymerase transcribes Three RNA polymerases exist, one
all three classes of genes for each class of genes.
(mRNA, rRNA, and tRNA).
Genes lack introns, mRNA is not spliced. Genes contain introns and mRNA
is spliced before translation.
mRNA does not undergo processing mRNAs undergo two other post-
no 5’ cap or 3’ poly A(+) tail transcriptional processing events
5’ capping and 3’ polyadenylation
polycistronic messages. Monocistronic messages.
Ribosome binds to an internal ribosome Most mRNAs do not contain internal
entry site in the mRNA (Shine-Dalgarno ribosome entry sites. Ribosome binds
sequence). mRNAs can have multiple to the 5’ cap and scans toward the 3’
cistrons, each one proceeded by end until the first AUG is reached and
a SD sequence. translation begins.

2. 2. Describe the contributions of the aminoacyl t-RNA synthetases
and ribosomes to the fidelity (accuracy) of protein synthesis.
Aminoacyl tRNA synthetases join the correct amino acid to the tRNA.
-They interact with several parts of the tRNA to sense that the anticodon is
correct for the amino acid
-They have an editing site that binds to a similar, but incorrect amino acid
causing the amino acid to be removed by hydrolysis of its AMP and release from
the synthetase.
The ribosome decodes the mRNA and selects the correct tRNA.
-It compares the codon in the A-site with the anticodon of the incoming tRNA

3. 3. Which statement best describes translation initiation in eukaryotic cells?
The translation start codon (AUG) is selected by interactions
between the ribosome and the Shine-Dalgarno sequence.
Because the ribosome assembles on the translation initiation codon,
eukaryotic mRNAs are often polycistronic.
Initiation factors bind to the 5’ cap and the 3’ poly A tail of the
mRNA to ensure it is intact prior to initiation of protein synthesis.
eIF-2B uses the energy of GTP to accelerate ribosome movement
along the mRNA

4. 4A. Predict the consequences of each mutation shown above
The effect of the mutations from left to right are:
(1) Mutation of the promoter (TATA box) - transcription would be slower.
(2) C to T mutation – mutation occurs in 5’ untranslated region; no effect.
(3) Mutation of the translation initiation codon - translation is initiated at the next ATG resulting
in a truncated protein. If the next ATG is in the wrong reading frame, a small,
nonfunctional polypeptide may be produced.
(4) TAT is changed to a stop codon, TAA. Protein synthesis may be aborted.
(5) CCC is changed to CCT. Both code for proline. This is a silent mutation.
(6) An extra C is inserted into the gene sequence. This changes the reading frame
(+1 frame shift). The resulting polypeptide is likely to be small and nonfunctional because
stop codons appear ~1 in 20 codons when mRNA is translated in the wrong frame.

5. (6) TTG (leucine) is changed to TCG (serine)
(7) and (8) Mutations at the 5’ and 3’ ends of the introns. The normal splice donor and
acceptor sites are mutated and normal splicing cannot occur. Abnormal splicing gives
rise to nonfunctional messages.
(9) Stop codon (TAG) mutated to a serine codon (TCG). Protein synthesis does not
terminate at the correct amino acid and a protein with a longer carboxy-
terminal end will be produced. Often such proteins are partially or fully active.
(10) The binding site for the cleavage and polyadenylation specificity factor has been mutated.
If the mutation inhibits binding of this factor, the mRNA will not be polyadenylated and
will be targeted for destruction.
3B. Identify the missense mutation, the frame shift mutation and the nonsense mutation.
Missense mutation – TTG (leucine) to TCG (serine)
frame-shift mutation – addition of C
nonsense mutation -TAT (tyrosine) to TAA (stop)
Missense is the change of one amino acid to another. The strand can still be read, but the meaning is different.

6. 5’ - CGTATATCCTATGGCCCTGAC - 3’ (Normal)
5’ - CGTATATCTATCCTATGGCCCTGA - 3’ (Mutant)
5A. What kind of mutation caused Tay-Sachs disease?
Tay-Sachs disease is caused by an insertion of a tetranucleotide TATC.
Since the number of inserted nucleotides is not divisible by 3, the insertion causes a frame shift.
5B. What differences would you expect to find in the amino acid sequences of proteins produced from the mutant gene and from the normal gene?
Frame shifts almost always cause the synthesis of a very short, non-functional polypeptide since there is a high probability that the ribosome will encounter a stop codon when messages are transcribed in the wrong reading frame.

7. Cycloheximide: elongation.
6A. Which step in protein synthesis does edeine inhibit? Cycloheximide?
Edeine: initiation.
Most ribosomes on mRNAs are involved in elongation. These ribosomes, which have already initiated protein synthesis, continue to translate the mRNA until finished. Edeine then binds the 40S subunit and prevents re-initiation.
Cycloheximide: elongation.
Since ribosomes spend most of their time in the elongation phase of protein synthesis, inhibition is instantaneous.
6B. Why is there a lag between the addition of edeine and the cessation of protein synthesis? What determines the length of the lag?
The delay represents the time needed for ribosomes to finish protein synthesis that has already been initiated.The duration of the lag depends on the average length of the messages being translated.
Add
inhibitor
Radioactivity
in globin
edeine
cycloheximide
Time (minutes)

8. 6C. Why are there no polyribosomes in extracts of edeine treated cells?
Would you expect to find polyribosomes in extracts of cycloheximide
-treated cells. Why?
The absence of polyribosomes in edeine treated cells is consistent
with its inhibition of initiation but not elongation. Elongating polyribosomes finish
synthesizing the polypeptide, dissociate from the message and are then inhibited
from re-initiating synthesis.
Yes, Cycloheximide stabilizes polyribosomes by blocking elongation and preventing
ribosomes from running off the message.
6D. Would edeine and cycloheximide be useful for treating patients with
bacterial infections? Explain.
Probably not as edeine and cycloheximide inhibit eukaryotic translation and
would adversely affect the patient’s cells.