1. Part I: Ribozymes Part II: SELEX (RNA in-vitro evolution) Part III: RNAi RNA inhibition and silencing Prof. F.Allain 2/2/2004

2. The RNA world hypothesis

3. Part I: Ribozymes A brief History How many ribozyme ? Why ? Catalytic efficiency, condition 3D structure of ribozyme: And a mechanism of catalysis Biological application ?

4. A brief History 1982:Self-splicing in Tetrahymena pre-rRNA (group I intron) Kruger et al, and Cech, Cell 31, 147-157 (1982) 1983:RNAse P is a ribozyme Guerrier-Takada et al, and Altman, Cell, 35, 849-857 (1983)

5. How many ribozyme ? Why ? - the hammerhead ribozyme (plant virus) - the hairpin ribozyme (plan virus) - hepatitis delta ribozyme (human virus) - neurospora VS ribozyme (mitochondrial RNA) - group I and group II intron ribozyme (rRNA and mt RNA) - RNAse P (tRNA maturation) - Ribosome (translation) - Spliceosome ?? (splicing)

6. One main reaction: Nucleolytic cleavage Transesterification (SN2) From Lilley TIBS (2003) Hammerhead Haipin Hepatitis delta VS ribozyme

7. The hammerhead ribozyme (plant virus) - discovered in small RNA satellites of small viruses (1986) - replication by rolling circle mechanism Secondary structure

8. The hammerhead ribozyme (plant virus) - tertiary structure Scott et al and Klug, Science 1996

9. The hairpin ribozyme (plant virus) From Lilley TIBS (2003)

10. The hepatitis delta ribozyme (human virus) From Lilley TIBS (2003)

11. Group I &II intron ribozyme (rRNA and mt RNA) Doudna and Cech Nature, 2002

12. Group I intron ribozyme (rRNA and mt RNA) Golden et al, and cech Science (1998)

13. Catalytic efficiency, condition - ribozyme follows a Michaelis-Menten kinetics E + SES E + P k1k1 k2k2 k-1k-1 - all ribozyme need cations for activity (Mg 2+,Mn 2+ ) Km=Km= k -1 + k 2 k1k1 = 10 -5 -10 -7 M k cat = 0.5-2 min -1 k cat / K m = 10 3 -10 6 M -1.min -1 Good catalytic efficiency!!

14. 3D structure of ribozyme: mechanism of catalysis hairpin ribozyme Hepatitis delta ribozyme Ruppert et al, Nature 2001, Science 2002 Ferre dAmare, Nature 1998

15. From Lilley TIBS (2003) How to catalyse the reaction ?

16. Structure of the hairpin ribozyme hairpin ribozyme Ruppert et al, Nature 2001, Science 2002

17. hairpin ribozyme Ruppert et al, Nature 2001 Ruppert et al, Science 2002 Transition stateGround state

18. hairpin ribozyme Loop A free bound Loop B freebound

19. hairpin ribozyme Ruppert et al, Science 2002 Transition state

20. Acid-Base catalysis ? (textbook Voet and Voet) like with RNAse A

21. Acid-Base catalysis ? G8 as a base A38 as an acid Bevilacqua, Biochemistry 2003

22. Hepatitis delta ribozyme Ferre dAmare, Nature 1998

23. Biological application ? Tentative of gene therapy with the hairpin and the hammerhead ribozyme against viral RNA for example.

24. Reference: Reviews: Lilley TIBS (2003) De Rose Chem & Biol (2002) Ferre dAmare Biopolymer (2003) Article: Kruger et al, and Cech, Cell (1982) Guerrier-Takada et al, and Altman, Cell (1983) Scott et al Nature (1995) Science (1996) Rupert et al Nature (2001), Science (2002)

25. Part II: SELEX A brief History The method ? A few examples. Biological application ?

26. SELEX : Systematic Evolution of Ligands by EXponential enrichment A brief History Ellington and Szostak, Nature (1990) Tuerk and Gold, Science (1990)

27. In vitro selection of RNA molecules that bind specific ligands Andrew D. Ellington & Jack W. Szostak Subpopulations of RNA molecules that bind specifically to a variety of organic dyes have been isolated from a population of random sequence RNA molecules. Roughly one in 10 10 random sequence RNA molecules folds in such a way as to create a specific binding site for small ligands. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Tuerk C, Gold L. High-affinity nucleic acid ligands for a protein were isolated by a procedure that depends on alternate cycles of ligand selection from pools of variant sequences and amplification of the bound species. Multiple rounds exponentially enrich the population for the highest affinity species that can be clonally isolated and characterized. In particular one eight-base region of an RNA that interacts with the T4 DNA polymerase was chosen and randomized. Two different sequences were selected by this procedure from the calculated pool of 65,536 species. One is the wild-type sequence found in the bacteriophage mRNA; one is varied from wild type at four positions. The binding constants of these two RNA's to T4 DNA polymerase are equivalent. These protocols with minimal modification can yield high-affinity ligands for any protein that binds nucleic acids as part of its function; high-affinity ligands could conceivably be developed for any target molecule.

28. Wilson and Szostak, Ann.Rev.Bioc. (1999)

29. - Selection against small molecules - Selection against proteins - Selection of new ribozymes (RNA world)

30. The ATP aptamer structure

31. Nucleolin RNA Targets B1 10-50nM (5ETS) Mouse B2 50-100nM (5ETS) Mouse G-C A-U G-C U-G 5 3 U C C C A G A C C-G G-C U-A A-U C U C C C A G G U Consensus NRE 5 3 N-N Nx U/G C CC G/A G Ny selex NRE 5-20nM 5 3 C A AU GA G-C G A U C C A G A

32. RBD2-RNA-RBD1 sandwich 5 3 1 G16 22 F56 5 3 RBD2 RBD1 linker Allain et al, EMBOJ (2000)

33. In vitro selection of an enzyme

36. Reference: Reviews: Wilson and Szostak Ann.Rev.Bioch.(1999) Gold et al, Ann.Rev.Bioch.(1995)

37. Part III: Introduction to RNAi A brief History SiRNA and miRNA RNAi Mechanism A few very recent structures Biological application A practical example of siRNA

38. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans ANDREW FIRE*, SIQUN XU*, MARY K. MONTGOMERY*, STEVEN A. KOSTAS*, SAMUEL E. DRIVER & CRAIG C. MELLO Experimental introduction of RNA into cells can be used in certain biological systems to interfere with the function of an endogenous gene,. Such effects have been proposed to result from a simple antisense mechanism that depends on hybridization between the injected RNA and endogenous messenger RNA transcripts. RNA interference has been used in the nematode Caenorhabditis elegans to manipulate gene expression,. Here we investigate the requirements for structure and delivery of the interfering RNA. To our surprise, we found that double-stranded RNA was substantially more effective at producing interference than was either strand individually. After injection into adult animals, purified single strands had at most a modest effect, whereas double-stranded mixtures caused potent and specific interference. The effects of this interference were evident in both the injected animals and their progeny. Only a few molecules of injected double-stranded RNA were required per affected cell, arguing against stochiometric interference with endogenous mRNA and suggesting that there could be a catalytic or amplification component in the interference process. Nature V391 pp 806-811 (1998)

39. + DS RNA against GFP Fire at al, Nature V391 pp 806-811 (1998)

40. In situ mRNA hybridization of Mex3 RNA in Embryo -C+C From animal: with AntisensRNA with DS RNA Fire at al, Nature V391 pp 806-811 (1998)

41. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Zamore PD, Tuschl T, Sharp PA, Bartel DP. Double-stranded RNA (dsRNA) directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Using a recently developed Drosophila in vitro system, we examined the molecular mechanism underlying RNAi. We find that RNAi is ATP dependent yet uncoupled from mRNA translation. During the RNAi reaction, both strands of the dsRNA are processed to RNA segments 21-23 nucleotides in length. Processing of the dsRNA to the small RNA fragments does not require the targeted mRNA. The mRNA is cleaved only within the region of identity with the dsRNA. Cleavage occurs at sites 21-23 nucleotides apart, the same interval observed for the dsRNA itself, suggesting that the 21-23 nucleotide fragments from the dsRNA are guiding mRNA cleavage Cell, v101 pp25-33 (2000)

42. dsRNAi is cut in 21-23 nt fragments Zamore et al, Cell, v101 pp25-33 (2000)

43. The mRNA is cut in 21-23 nt fragments by the siRNA Zamore et al, Cell, v101 pp25-33 (2000)

44. A first model for the mechanism RNAi Zamore et al, Cell, v101 pp25-33 (2000)

45. Role for a bidentate ribonuclease in the initiation step of RNA interference. Bernstein E, Caudy AA, Hammond SM, Hannon GJ.. RNA interference (RNAi) is the mechanism through which double-stranded RNAs silence cognate genes. In plants, this can occur at both the transcriptional and the post-transcriptional levels; however, in animals, only post-transcriptional RNAi has been reported to date. In both plants and animals, RNAi is characterized by the presence of RNAs of about 22 nucleotides in length that are homologous to the gene that is being suppressed. These 22-nucleotide sequences serve as guide sequences that instruct a multicomponent nuclease, RISC, to destroy specific messenger RNAs. Here we identify an enzyme, Dicer, which can produce putative guide RNAs. Dicer is a member of the RNase III family of nucleases that specifically cleave double-stranded RNAs, and is evolutionarily conserved in worms, flies, plants, fungi and mammals. The enzyme has a distinctive structure, which includes a helicase domain and dual RNase III motifs. Dicer also contains a region of homology to the RDE1/QDE2/ARGONAUTE family that has been genetically linked to RNAi. Nature v 409, pp 363-366 (2001)

46. 22 nt RNA Identification of DICER Bernstein et al, Nature v 409, pp 363-366 (2001)

47. Elbashir et al, G&D, v18 pp188-200 (2001) The RISC complex

48. SiRNA and miRNA MicroRNAs. Genomics, Biogenesis, Mechanism, and Function. Bartel DP. MicroRNAs (miRNAs) are endogenous approximately 22 nt RNAs that can play important regulatory roles in animals and plants by targeting mRNAs for cleavage or translational repression. Although they escaped notice until relatively recently, miRNAs comprise one of the more abundant classes of gene regulatory molecules in multicellular organisms and likely influence the output of many protein-coding genes. Cell, v116, pp 281-297 (2004) (review)

49. First miRNA in C.elegans miRNA in C.elegans with homologs In flies and human miRNA in Plants

50. A high number: about 1% of the genes Human: 200-255 miRNA C.elegans: 103-120 miRNA Drosophila: 96-124 miRNA

51. Functions ??

52. miRNAsiRNA

53. Post-transcriptional Cleavage of mRNA Translational repression of the mRNA Transcriptional silencing

54. Structure of the PAZ domain Lingel et al and Yan et al, Nature 426, pp 465-474 (2003)

55. Structure of an Viral siRNA suppressor Vargason et al, Cell 115, pp 799-811 (2003)

56. Applications: -Genome study (C-elegans) -Gene knockout

57. Reference: Reviews: Bartel Cell.(2004) Hannon Nature (2002) Article: Fire at al, Nature V391 pp 806-811 (1998) Elbashir et al, G&D, v18 pp188-200 (2001) Bernstein et al, Nature v 409, pp 363-366 (2001)

58. RNAi as a tool for knock down in mammalian cells Why ? Which is the right siRNA sequence ? How do I get the siRNAs into the cell ? Practical aspects

59. RNAi vs Knock-Out + RNAi:relatively easy to perform not so time consuming no real transgenic cells or animals - RNAi:its just a knock down finding siRNAs is not always easy negative controls

60. Designing siRNA The target sequence should be 50-100 bp downstream of start codon or in the 3 UTR Search for a 23nt long sequence with a AA(N19)TT or NA(N21) motif Ensure that your target sequence is not homologous to any other genes Avoid more than three guanosines or three cytosines in a row avoid stretches of > 4 T's or A's secondary structure of the target mRNA does not appear to have a strong effect on silencing Designing several siRNAs helps to find a highly efficient one

61. Lamin A/C targeted region (cDNA): 5' AACTGGACTTCCAGAAGAACATC sense siRNA: 5' CUGGACUUCCAGAAGAACAdTdT antisense siRNA: 5' UGUUCUUCUGGAAGUCCAGdTdT Example for siRNAs GL2 Luciferase targeted region (cDNA): 5' AACGTACGCGGAATACTTCGATT sense siRNA: 5' CGUACGCGGAAUACUUCGAdTdT antisense siRNA: 5' UCGAAGUAUUCCGCGUACGdTdT Elbashir, Nature. 2001 May 24;411(6836):494-8.

62. Delivering Double Stranded RNA Hannon, Nat Rev Genet. 2001 Feb;2(2):110-9

63. dsRNA Approach It is possible to get dsRNA commercially, either as two single stranded RNAs or already annealed Commercially available RNAs are produced by solid phase synthesis Another possibility is to get dsRNA by T7 in vitro transcription: DNA oligos are the templates Annealing of antisense and sense product will give dsRNA After purification they are useable Normally the T7 procedure is cheaper and even faster (incl. oligo ordering) For one transfection reaction around 0.2 mM siRNA is necessary Transfections are carried out by cationic lipids Due to secondary structure dsRNA is rather stable, compared to ssRNA

64. EXAMPLE: combinatorial control of splicing in the c-src N1 exon Black, Annu Rev Biochem. 2003;72:291-336

65. HeLa-cell-line 1775 or 1808 hPTB siRNA in 3UTR + minigene 1. Transfection (Lipofectamin 2000) 2. Transfection 48 h (Lipofectamin 2000) whole proteom isolation 96 h cytoplasmatic RNA isolation 96 h check protein expression via western 1775 or 1808 hPTB siRNA in 3UTR check alternative spliced exon via RT-PCR EXAMPLE: combinatorial control of splicing in the c-src N1 exon Wagner, Mol Cell. 2002 Oct;10(4):943-9

66. Plasmid Approach Ambion Inc. Austin, Texas, USA

67. Lentivirus-Based Approach: shRNA-expressing vector Rubinson, Nat Genet. 2003 Mar;33(3):401-6 Self-inactivating long terminal repeats HIV packing signalcontrol purine track Promotor Cytomegalovirus promootor Woodchuck hepatitis Virus response element

68. Functional silencing of genes in mice by Lentivirus-infection Generation of lentivirus infected zygotes Silencing of p53: Tissue was harvested from 8-wk-old mices

69. Summary ProsCons Fast Effective Works in many systems Non-inducible Most effective in embr. System Time dependent Stable Inducible Tissue specific Time consuming to generate Cloning can be problematic Stable Inducible Tissue specific Time consuming to generate Promotor can silence each other Most commen technique in plants Also in non cycling cells possible Therapeutically useful Resistance Not well established Difficult to work with