Presentation is loading. Please wait.

Presentation is loading. Please wait.

Welcome to Jeopardy!.

Similar presentations


Presentation on theme: "Welcome to Jeopardy!."— Presentation transcript:

1 Welcome to Jeopardy!

2 Final Jeopardy Round 1 Round 2

3 Which Came First? DNA vs. RNA Not Quite X Men Gene Switch T & T Biotech Round 1 $200 $200 $200 $200 $200 $200 Final Jeopardy $400 $400 $400 $400 $400 $400 Scores $600 $600 $600 $600 $600 $600 $800 $800 $800 $800 $800 $800 $1000 $1000 $1000 $1000 $1000 $1000

4 What sugar is found in a nucleotide of…
$200 What sugar is found in a nucleotide of… DNA? RNA?

5 $200 DNA: deoxyribose RNA: ribose
Scores

6 Contains specific sequences that code for proteins
$400 Contains specific sequences that code for proteins

7 $400 DNA Scores

8 A terminator is a sequence of (DNA/RNA) that marks the end of a gene
$600 A terminator is a sequence of (DNA/RNA) that marks the end of a gene

9 $600 DNA Scores

10 If a DNA sequence is TGA, what is the tRNA anticodon?
$800 If a DNA sequence is TGA, what is the tRNA anticodon?

11 $800 UGA Scores

12 DNA sequence that will produce the mRNA codon of UGC
$1000 DNA sequence that will produce the mRNA codon of UGC

13 $1000 ACG Scores

14 $200 Process during which RNA nucleotides are matched with complimentary DNA nucleotides

15 $200 Transcription Scores

16 Daily Double

17 Enzyme that links together RNA nucleotides to form RNA
$400 Enzyme that links together RNA nucleotides to form RNA

18 $400 RNA Polymerase Scores

19 $600 Molecule that recognizes a codon in order to match the proper amino acid

20 $600 Transfer RNA Scores

21 $800 A protein made of 210 amino acids was coded by a mRNA of at least this many codons

22 $800 210 codons Scores

23 mRNA codon that will be created based on this DNA template
$1000 5’ TAC 3’ mRNA codon that will be created based on this DNA template

24 $1000 5’ TAC 3’ 3’ AUG 5’ 5’ GUA 3’ Scores

25 $200 A mutation is caused by a change in the nucleotide sequence of (DNA/RNA)

26 $200 DNA Scores

27 Two examples of frameshift mutations
$400 Two examples of frameshift mutations

28 $400 Insertion Deletion Scores

29 $600 Type of point mutation that changes every amino acid after the mutated nucleotide

30 $600 Frameshift mutation Scores

31 Type of mutation that has no effect on resulting protein
$800 Type of mutation that has no effect on resulting protein

32 $800 silent Scores

33 $1000 Two types of mutations that may result in an amino acid change only at the mutation point

34 $1000 Missense Nonsense Scores

35 Why eukaryotic body cells composed of the same genes can be so diverse
$200 Why eukaryotic body cells composed of the same genes can be so diverse

36 Different genes turned on/off in different cells
$200 Different genes turned on/off in different cells Scores

37 Process that allows 30,000 genes code for 100,000 proteins
$400 Process that allows 30,000 genes code for 100,000 proteins

38 $400 Alternate splicing Scores

39 Daily Double

40 $600 Component of prokaryotic genes that allow them to adapt to the changing environment

41 $600 Operon Scores

42 $800 Based on this diagram, there are (high/low) levels of tryptophan present in the environment

43 $800 Low The operon is not blocked, so tryptophan can be produced from this gene. Tryptophan will be made until there is enough, or too much, in the environment. Scores

44 In this diagram, the operon is turned (on/off). Explain.
$1000 In this diagram, the operon is turned (on/off). Explain.

45 $1000 Off! The co-repressor (tryptophan) is bound to repressor, giving the repressor the correct shape to bind with the operon and block RNA polymerase Scores

46 $200 DNA created by combining DNA fragments from organisms of different species.

47 $200 Recombinant DNA Scores

48 End of a DNA fragment that contains single-stranded nucleotides
$400 End of a DNA fragment that contains single-stranded nucleotides

49 $400 Sticky end Scores

50 $600 Bonds that sticky ends will form with complementary sticky ends to form recombinant DNA

51 $600 Hydrogen bonds Scores

52 $800 How many restriction sites? How many fragments? Bcl I T↓GATCA
5’ TTTGATCAAACCGGTGATCATGCCCTTAA 3’ 3’ AAACTAGTTTGGCCACTAGTACGGGAATT 5’ How many restriction sites? How many fragments?

53 $800 5’ TTT↓GATCAAACCGGT↓GATCATGCCCTTAA 3’
3’ AAACTAG↓TTTGGCCACTAG↓TACGGGAATT 5’ 2 restriction sites 3 fragments Scores

54 $1000 Create a gel electrophoresis based on the above DNA
5’ TTT↓GATCAAACCGGT↓GATCATGCCCTTAA 3’ 3’ AAACTAG↓TTTGGCCACTAG↓TACGGGAATT 5’ Create a gel electrophoresis based on the above DNA 10 8 5 2

55 $1000 Scores

56 RNA Polymerase binds to DNA
$200 Which came first? RNA Polymerase binds to DNA or DNA unwinds

57 $200 DNA unwinds Scores

58 Anticodon binds to codon Amino acid binds to growing protein chain
$400 Which came first? Anticodon binds to codon Or Amino acid binds to growing protein chain

59 Anticodon binds to codon
$400 Anticodon binds to codon Scores

60 mRNA binds with ribosome Or
$600 Which came first? mRNA binds with ribosome Or Introns are removed and exons are spliced together

61 Introns are removed and exons are spliced together
$600 Introns are removed and exons are spliced together Scores

62 $800 Which came first? Terminator Or Stop codon

63 $800 terminator Scores

64 $1000 Which came first? DNA ligase Or Restriction enzyme

65 $1000 Restriction enzyme Scores

66 Final Jeopary Question
Jeopardy Final Jeopary Question Scores

67

68 Scores


Download ppt "Welcome to Jeopardy!."

Similar presentations


Ads by Google