1. SIT DOWN AND PREPARE THY SELF!!!! …Paper and pencil would also be nice 

2. Competition time!
1.) Which amino acids correspond with the following Anti-codons? UAG AAU AUC CCG GGG UGA
2.) Write two codon sequence possibilities for the following amino acid chain.
Serine-valine-alanine-glycine-leucine-STOP
3.) Take your codon sequence from problem 2, replace all A’s with U’s and all G’s with A’s: write the new amino acid sequence.

11. RNA and Protein synthesis
Mr. Nichols PHHS

12. Time to act!
Group 1: Creation of mRNA including transcription factors.
Group 2: How tRNA binds with a particular amino acid.
Group 3: How the ribosome works to create a protein.
Group 4: What happens once the stop codon is read.
Group 5: Examples of what proteins are used for and what happens to them once they’re done being used.

14. Even More detail

15. Summary
tRNA synthetase grabs the tRNA and appropriate amino acid and links them together by using the energy of an ATP molecule.
Once the ATP’s energy is used to create a high energy bond the tRNA and amino acid are released and then travels to the ribosome.
Video 

16. A little more detail!
A Transcription factor is a protein that binds to specific DNA sequences, thereby controlling the of genetic information from DNA to mRNA. Transcription factors perform this function alone or with other proteins in a complex, by promoting (as an activator), or blocking (as a repressor) the recruitment of RNA polymerase.
-Upregulation, activation, or promotion – increase the rate of gene transcription.
-Downregulation, repression, or suppression – decrease the rate of gene transcription.

17. Even more 
Coactivator – a protein that works with transcription factors to increase the rate of gene transcription.
Corepressor– a protein that works with transcription factors to decrease the rate of gene transcription by blocking the binding of RNA polymerase to DNA
Common Transcription Factors associated with diseases:
MECP2- Rett’s Syndrome
MODY- Diabetes
FOXP3- Autoimmune Diseases (I study this one )
STAT- Breast Cancers
HOX- Multiple Cancers

18. the “Central Dogma Theory”
DNA provides the code on how to construct RNA and RNA provides the code on how to create proteins.
Created by Francis Crick in 1959.
This theory is the basis for how proteins are created and the role DNA plays in the process.

19. Where do we start?
RNA
DNA

20. Step One: Transcription
DNA unzips: Helicase splits apart base pairs and unwind the DNA double helix.
Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase.
New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

21. What does this look like?
Gene: A region of DNA that codes for a protein.

22. What does this look like?

23. What does this look like?
mRNA
This process is called Transcription!!!

24. Try it out!
Try it! What RNA strand will be made from the following DNA sequence?

25. AUGCGUACUGAUCGUUCAGAUUGA
Get it right?
Try it! What RNA strand will be made from the following DNA sequence?
AUGCGUACUGAUCGUUCAGAUUGA

26. Summary: How to create RNA from dna
RNA is a single stranded copy of one DNA strand.
An enzyme called RNA polymerase attaches to a strand of DNA and copies it.
The copied strand is referred to as mRNA (messenger RNA) and is the instructions on how to make proteins.
RNA is single stranded and replaces Thymine (T) with a new base called Uracil (U).

27. Step 2: Translation AKA: protein synthesis
The mRNA enters the ribosome (like a lace through a shoe).

28. Problem? Problem: There are 20 different amino acids.
There are 4 RNA bases. A T C G
phe
ile
val
pro
ala
his
asn
asp
cys
arg
leu
met
ser
thr
tyr
gln
lys
glu
trp
gly

29. What codon’s refer to

30. Step Two: Translation AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?
Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon:
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ?
met

31. Step Two: Translation AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon:
AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA
met
arg
thr
asp
arg
ser
asp
???

32. Step 2 in protein synthesis
Another RNA molecule called tRNA (transfer), bind themselves to a specific amino acid and bring them to the ribosome.
Humans use 20 main amino acids, there is a unique tRNA for each amino acids.
Recall: Proteins are made of amino acids.

33. Step 2 in action

34. Step 3: Reading the mrna
When both the tRNA and mRNA find their way into the ribosome they check one other. Meaning:
mRNA and tRNA have their bases read in 3’s, a sequence of 3 bases in a row is called a “Codon.”
If the tRNA’s “Anti-codon,” and mRNA’s “codon” are able to base pair together, the tRNA transfers it’s amino acid to a pocket of the ribosome.
These amino acids are then combined with other amino acids to create a protein.

35. Step 3 in action

36. Step 4: Finish him!!!
When the protein has all of it’s necessary amino acid parts in the ribosome the mRNA tells the process to stop by having a STOP CODON in it’s sequence.
The protein then travels to the Rough Endoplasmic Reticulum (ER) or the Golgi Apparatus to be folded.
Proteins must be folded to be functional.

37. What codon’s refer to

38. Closure
I got your back!
Each person will have a vocabulary word taped to their backs.
Students will pair up and try and discover what’s on their back by asking their partner questions.

39. Cartoon of the Day!

40. Cartoon of the Day

42. Cartoon of the day!

43. Cartoon of day!

44. Question of the Day!
Write the amino acid sequence for the following codon sequence:
UGAAUGGAAACCCUCACUUAA

50. Cartoons of the Day!

59. Science Club agenda Bonding Behavior/Nomenclature
Line diagrams/Intro to the mother carbon chain
Introduction to Alkane and cycloalkane naming.
Club officers and future endeavors/topic matter.
Next week’s adventure: Introduction to Alkane Reactions

60. Naming Basics -meth Common Substituents: -eth -bromo, chloro
-prop -methyl, ethyl
-but -benzyl,
-pent
-hex
-hept
-oct
-non
-dec

61. Questions of the Day!
1.) Are humans more or less intelligent on average as compared to 1000 years ago? Explain why or why not.
2.) Write down the following DNA Sequence:
ATCAACGGCACGACGATC
-Transcribe the following sequence. What is the Amino Acid sequence?
-Invert the 3rd and 4th codon
-How has the amino acid sequence changed?