Presentation is loading. Please wait.

Presentation is loading. Please wait.

mRNA attaches to a Ribosome

Published bySucianty Sudjarwadi Modified over 5 years ago

Similar presentations

Presentation on theme: "mRNA attaches to a Ribosome"— Presentation transcript:

1 mRNA attaches to a Ribosome
Translation Step 1 mRNA attaches to a Ribosome Ribosome UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA

2 Translation Step 2 Every group of three RNA nitrogen bases is called a codon. The ribosome finds and begins at the “start codon” AUG. Ribosome Start Codon Codon UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA 2

3 Translation Step 3 Transfer RNA’s (tRNA) bring amino acids to the Ribosome. Each tRNA has an “anticodon” that matches to a codon on mRNA. Amino Acid Met Ribosome tRNA Anticodon Codon UAC UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA 3

4 Translation Step 4 As more tRNA’s bring amino acids they bind together to form a polypeptide. Polypeptide Met Gly Tyr Ribosome tRNA tRNA tRNA UAC CCG AUG UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA 4

5 Translation Step 5 The Ribosome moves down the mRNA adding amino acids to the polypeptide until it reaches the “stop codon”, the ribosome then releases the polypeptide. Met Tyr Lys Gly Polypeptide tRNA tRNA AUG GAU Stop Codon UGUGCUGUCUUGUCUGAUGGGCUACCUAUAA mRNA 5

6 Translation So What?? The importance of translation is that it makes sure the sequence of amino acids used to assemble a protein is perfect. *If just one amino acid is missing or out of order then the protein could not work at all or function in a way that damages the cell. 6

Download ppt "mRNA attaches to a Ribosome"

Similar presentations

TRANSLATION The process of converting the information stored in mRNA into a protein is called translation mRNA carries information from a gene to a structure.

TRANSLATION The process of converting the information stored in mRNA into a protein is called translation mRNA carries information from a gene to a structure.
 Type of RNA that functions as an interpreter in translation  Each tRNA molecule has a specific anticodon and a site of attachment for an amino acid.

 Type of RNA that functions as an interpreter in translation  Each tRNA molecule has a specific anticodon and a site of attachment for an amino acid.
Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.

Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.
Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).

Gene to Protein Part 2: Translation After the mRNA transcript leaves the nucleus it goes to a ribosome (site of protein synthesis).
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
Protein Synthesis. Review! What are some functions of proteins? What are some functions of proteins? Enzymes, which speed up chemical reactions Enzymes,

Protein Synthesis. Review! What are some functions of proteins? What are some functions of proteins? Enzymes, which speed up chemical reactions Enzymes,
Chapter 13.2 Ribosomes and Protein Synthesis

Chapter 13.2 Ribosomes and Protein Synthesis
CFE Higher Biology DNA and the Genome Translation.

CFE Higher Biology DNA and the Genome Translation.
BELLRINGER: 10-31-10 Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.

BELLRINGER: Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.
Protein Synthesis Process that makes proteins

Protein Synthesis Process that makes proteins
Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.
12-3 RNA and Protein Synthesis

12-3 RNA and Protein Synthesis
11.5 NOTES: DNA TRANSLATION. 11.5 Notes: DNA Translation What does it mean to Translate? Translating the nucleic acid language to the protein language….using.

11.5 NOTES: DNA TRANSLATION Notes: DNA Translation What does it mean to Translate? Translating the nucleic acid language to the protein language….using.
Amino acids are coded by mRNA base sequences.

Amino acids are coded by mRNA base sequences.
Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.

Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.
Translation and Protein Synthesis Notes

Translation and Protein Synthesis Notes
8.5 Translation KEY CONCEPT Translation converts an mRNA message into a protein.

8.5 Translation KEY CONCEPT Translation converts an mRNA message into a protein.
Step 2 of protein synthesis: Translation “The players” 1.Transfer RNA (tRNA)  Folded into three-lobed shape (clover-like)  At one lobe, resides an anticodon.

Step 2 of protein synthesis: Translation “The players” 1.Transfer RNA (tRNA)  Folded into three-lobed shape (clover-like)  At one lobe, resides an anticodon.
Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?
RNA & Protein Synthesis Continued: Translation. Translation: mRNA Protein Translation is taking mRNA and making proteins Sequence of nucleotide bases.

RNA & Protein Synthesis Continued: Translation. Translation: mRNA Protein Translation is taking mRNA and making proteins Sequence of nucleotide bases.

Similar presentations

Ads by Google