Welcome BIO510 Recombinant DNA Techniques Lab

Welcome BIO510 Recombinant DNA Techniques Lab
Dr. Brian Rymond (Instructor) & Christen Wanstrath (TA)

What are we going to “do”
Make and break DNA (and RNA) in a variety of ways and test the consequences in the host organism (E. coli, S. cerevisiae, C. elegans) The experiments are all participant driven and provide hands on training in a (very) wide array of experimental techniques, such as……

Actual lab work DNA & Gene Activity Assays In vivo: Use CRISPR-Cas9 to target site-specific gene mutations; use RNAi to do specific mRNA knockdowns; use “plasmid shuffle” to score potentially lethal mutations In vitro: use inverse PCR to create site specific deletions on cloned DNA; use chemical mutagenesis to create random mutations on cloned DNA Protein Work Define protein-protein interaction domains using the yeast two-hybrid assay (Y2H); use affinity chromatography to purify a recombinant protein to near homogeneity; score the expression of TAP epitope-tagged proteins by western blot Other Assays Clone a fragment of the yeast genome & determine its sequence and the direction of transcription in vivo; create radioactive RNA riboprobes for northern blot assay; use reverse-transcriptase polymerase chain reaction (rtPCR) to confirm the existence of novel introns and rare alternative splice sites identified by deep sequence analysis; use of real time PCR to measure nucleic acid concentration in an unknown sample; transformation of DNA into E. coli and yeast; use of bacterial, yeast and nematode model organisms Visit UK Core Facilities for 1) microarray and Nanostring 2) Next generation DNA sequencing, 3) proteomics, and 4) a visit by the VP for Research & Development at Hera Biolabs Emphasis – Professional training, this is not a “typical” class

Today Review syllabus & course materials
Basics – pipetman & loading gel Complete online safety training

Canvas Modules site has the syllabus & labs plus related course materials such as PowerPoint slides used in lab & lecture (frequently updates), information on enzymes, reagents & techniques, papers that we will discuss, class data, etc.

2018 BIOLOGY 510 RECOMBINANT DNA TECHNIQUES LABORATORY
Lab: MW 2:00 – 4:50 p.m., 224 T.H. Morgan Lecture: F 2:00 – 2:50 p.m., 109 T.H. Morgan Instructor: Dr. Brian Rymond, 335A T.H. Morgan Building, 257‑5530, Office hours anytime by appointment (see me in class to arrange a time good for both of us) Teaching Assistant: Christen Wanstrath, Course Website: Our Canvas webpage contains a copy of the lab manual, Friday lecture & in-lab PowerPoint slides, reading assignments, examples of old quizzes and exams, and class data. Check this web site frequently for updates. Course Content: This four-credit course familiarizes the advanced undergraduate and the beginning graduate student with the theory and practice of recombinant DNA technology with molecular genetic applications. Emphasis is placed on learning a broad array of experimental techniques though intensive direct experimentation. The laboratory sections provide experience with techniques (e.g., DNA isolation and sub-cloning, prokaryotic/eukaryotic cell transformation, phenotypic selection of recombinant clones, RNAi knockdown, CRISPR-Cas9 & in vitro mutagenesis, protein purification, RNA analysis, real-time PCR, in vitro transcription, deep sequence validation ‑ among others) applicable in modern biomedical, ecological and industrial research. Each lab will begin with a brief overview of the experiment and discussion of our results to date. Students are highly encouraged to ask questions during the lab meetings about the lab experiments & experimental observations, homework assignments, scientific applications, outside scientific interests, etc. PowerPoint slides used during the lab periods will be posted on the class web site.

Dr. Rymond – lectures, quizzes, homework, exams
Chrissy Wanstrath – assistance in the lab Check Canvas often for assigned reading, lab results & to review PowerPoints presentations

Prerequisites: BIO 510 students require a working knowledge of fundamental genetic and biochemical principles. Prerequisites include GENETICS [Bio 304/404G or equivalent] and CELL BIOLOGY (BIO 315 or equivalent; Biochemistry BCH 401G can substitute for Cell Biology). While students may bypass these prerequisites upon consent of the instructor, time does not permit the review of basic genetic or biochemical principles. Students that require additional preparation are expected to use the background resources listed below and work independently to fill these needs. Required Textbook & Background resources: BIO 510 is a reading intensive course. The textbook, Principles of Gene Manipulation and Genomics, 7th Edition S.B. Primrose, R.M. Twyman (Blackwell Science Press, 2006), provides a general overview of many of the techniques and approaches we will use -available as a used textbook at the bookstore or at Amazon. This text was selected to bring the diverse BIO 510 student body to a common level of understanding as starting point for our lectures and discussions. The textbook is not a lab manual and is not meant to explain the lab exercises or substitute for your use of primary literature. Throughout the semester, students will be directed to read other relevant literature posted on the class website and to use multiple online literature resources and bioinformatic tools. Background reading in molecular biology and genetics include GENES VII (B. Lewin, Oxford Press), Molecular Biology of the Cell (B. Alberts et al., Garland Press); Genomes (T.A. Brown, Garland Science), Biochemistry (Berg et al., W. H. Freeman & Co., and Modern Genetic Analysis (Griffiths et al, WH Freeman). These and related books are searchable for free online at: The Cold Spring Harbor Press web site ( is a rich source for students seeking to purchase professional lab manuals.

Course prerequisites are real.
There is a textbook with assigned reading assignments (can be a source of quiz/test questions).

Lab Manual & Additional Materials: All laboratory exercises will be provided by the instructor in a protocol set. This lab manual contains hyperlinks to many important online resources (e.g., glossaries to define terms, descriptions of enzymes, genes, small molecules, protocols, data analysis tools) that students are expected to access and use. For the lab to move smoothly students are expected to complete all reading for each lab prior to the start of class. At least one unannounced quiz will be given each semester focused exclusively on the reading for that day’s lab assignment.

Joining DNA Ends with DNA Ligase
Each Lab Member. NOTE: The volumes of vector and insert DNA may need to be altered depending on your recovery so be sure to show the photograph of your gel to the instructor or T.A. before continuing. To increase the frequency of the bi-molecular ligation, we will use approximately 4X the molar amount of insert to vector. The insert is roughly 1/4 the length of the vector, so equal mass amounts of DNA (that is EtBr intensity bands) will give ~4X the molar amount of insert to vector. See pages in PGMG. Assemble the reaction in the following order: 10 μl of sterile water (or sufficient water have a final reaction volume of 20 μl 2 μl of 10X ligase buffer* 2 μl (or as directed by the T.A.) of the pTZ18 or 19u Hind/Eco cut vector 5 μl (or as directed by the T.A.) of isolated gel fragment (i.e., insert DNA) Mix briefly, then add: μl (1 to 2.5 units) of T4 DNA ligase. Mix briefly. ‑Each student should also set up a second, control ligation reaction as above but with additional water instead of insert DNA. This control will score the amount of vector self-ligation. Here are several outstanding WEB sites for Molecular Biology protocols and tools (most web-based, some as free downloads): DICTIONARY OF MANY COMMON GENETIC AND MOLECULAR BIOLOGY TERMS:

Each student will receive a free copy of New England BioLabs (NEB) product and resource catalog. The NEB catalog contains a wealth of information on many of the enzymes and reagents commonly used in a molecular biology lab. This book contains multiple appendices with practical information (genotypes of common bacterial strains, restriction maps, genetic code, etc.) and is well referenced with primary literature citations. Throughout the semester, you will be assigned required reading in the NEB catalog. You do not have to memorize the tables & graphs assigned in the NEB catalog but you will need to know how to use these tools for homework or in open book exam segments. Aug. 28: LAB 1. Agarose gel fractionation & purification of DNA; double restriction endonuclease digestion of vector DNA. Reading assignments: PDF files on Qiagen agarose gel recovery; New England Biolabs (NEB) catalog pages 16, (icon descriptions), 45 (HindIII-HF), 42 (EcoRI); 316 (High-Fidelity (HF) restriction enzymes; (alkaline phosphatase) 175 (Quick-load 1 kbp Extend DNA ladder; print out for your notebook), (restriction enzyme background), 359 (Getting Started with Molecular cloning), 367 (trouble shooting DNA purification). Aug. 30: LAB 2. Influence of DNA conformation on gel mobility; preparation of transformation competent E. coli. EtBr vs. SYBR safe; Reading assignments: PDF files on pTZ19u map (print out for your notebook); SYBR safe (posted); NEB (Online Interactive Tools); NEB (basic restriction enzyme use); 275 & 347 (methylation); Principles of Gene Manipulation & Genomics (PGMG) chapters 1-3 and Box 15.1 on pages

PLEASE NOTE that BIO 510 quizzes and exams will cover information presented in lectures, lab handouts, homework assignments, and assigned readings (e.g., textbook, NEB catalog, hyperlinks in this lab manual and special in-class assignments). Quizzes/Exams may include essays, short‑answer and multiple choice questions. One or more quizzes may be “open book” and require you to use your New England Biolabs catalog in class. To assure that students prepare for lab unscheduled quizzes may include content for that day’s lab period. There will be one “makeup” quiz and one makeup mid-term exam given in December for students who miss an earlier quiz or exam with an excused absence. The makeup quiz or exam will be “comprehensive” and cover topics presented from the first day of classes until the date of the makeup quiz or exam. Students who miss additional quizzes with excused absences will take the makeup and have their quiz + homework grade based on completed work. Students who miss a quiz or an exam without an excused absence will receive a grade of “0” for the missed quiz or exam. NOTE: health clinic receipts must be signed originals and will be accepted only after telephone validation with the health provider.

Laboratory notebook: Students are expected to accurately record and analyze every laboratory exercise in a laboratory notebook. The lab manual may be used instead of a separate lab notebook; please use blank sheets (or the back of protocol pages) to record you data. The notebook will be graded twice, once on the day of the mid-term exam and again at the end of the. In order to maximize the likelihood of getting full credit, students are encouraged to ask the instructor for feedback on notebook quality prior to submission for grading. To receive full credit for your notebook, be sure to address each of the following: Did you answer all of the questions that were in the lab protocols that required a formal response? Did you clearly indicate any changes in lab protocols? Did you label all graphs appropriately (X and Y axis with the correct units)? Did you draw the best straight line to connect the data points of your DNA or RNA standards? Did you indicate the position of your experimental data points? Did you fully label all gel or blot images with lane designations and note the positions of relevant bands (e.g., supercoiled plasmid DNA, the snRNA hybridization band)? Did you fully record all observations and include an evaluative interpretation/discussion of the experimental results? Where an experiment failed, did you present possible explanations? If you borrowed samples from another student to complete the experiment, did you state where the sample came from? In case of negative results, did you provide speculation on the specific steps that might have failed?

BIO 510 Homework assignments due at 5:00 PM on listed date
Due Date* Assignment 9/5/18 Required Communication between scientists is key to moving the discipline forward. Participate in current science literacy - Subscribe to the Scientist Magazine (( Also sign up for the online weekly updates during the registration. \ Get full credit by providing me with printout of online confirmation of your free online subscriptions. This subscription is for your interest & benefit – you will not be tested on this materials. Optional Truly outstanding free online books and articles based on cutting edge science are also available from the National Academies of Science ( ) and from the Howard Hughes Medical Institute ( 10 pts

You can either provide me with a hard copy of your homework in class or me an electronic copy – either way is fine.

Attendance Policy: Attendance is mandatory in lab and in lecture
Attendance Policy: Attendance is mandatory in lab and in lecture. Two unexcused absences (as defined by the UK University Bulletin: ) will lower your final grade by one letter. Three or four unexcused absences will lower your grade by two letter grades. More than four unexcused absences will result in a grade of E. To avoid falling behind in multi-part lab units, the lab partner of a student missing a lab will conduct the experiment for the absent student. As UK policy, students who miss 20% or more of class meetings with excused absences will be assigned a grade of I. Cell Phones: The BIO 510 lab is a busy and, at times, noisy environment. Nonetheless, in order to run smoothly, announcements and lab discussions occur throughout the lab period. Please turn off your cell phone upon entering the lab so that you do not miss information critical to your success in this class. Each violation of the cell phone (or laptop computer) use policy e.g., calls, texting, or web browsing unrelated to this course will reduce your “participation” grade by one point. No eating or drinking of any sort in the BIO 510 lab. You should not discard any food wrappers, empty cans or bottles in the BIO 510 trash cans since this would be cited as a health violation.

Grading Policy: Your grade will be assigned based on your performance in:
Exam % Exam Quizzes plus homework 30 Notebook 10 Class participation 10 (note, does not include homework assignments) ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ 100% *Will actually count the better of the 2 grades as 35% and the lower as 15% Numerical Grade Letter Grade (The +/- grading system will not be used for BIO 510) 100‑90 A 89‑ B 79‑ C 69‑ D (not available for graduate students) < E Undergraduate students get to drop the lowest 10-point homework grade from the first half and second half of the semester. The 20-point “extended homework” assignments and quizzes are excluded

Lab order and design. A major goal of the lab is to have students is to equip students with the professional skills needed to work as a molecular biologist. Consequently, we seek to have our students learn and apply as many molecular biological approaches as possible. Many protocols in molecular biology might be called “hurry up and wait” experiments where one step in a protocol (e.g., cell transformation) is initiated then requires hours (or days) to “finish”. Consequently, we usually work on several different lab exercises in parallel. That is, we carry our “parts” of several experiments in each lab meeting – this is the norm in a research lab but uncommon in university lab courses. Organization is key to success in BIO read the labs before class and keep a running list of experiments and outcomes. The flow chart shown below provides an overview of what we hope to accomplish during the first half of the semester. A central “theme” of this work might be termed “characterization of a eukaryotic gene”. The most important goal, however, is for you to learn as much recombinant DNA technology as possible. With this in mind, you will note that we include experiments that teach important concepts/techniques but do not directly relate to the characterization of the DNA provided in our first working lab.

FIRST Half of the Semester
Thematic Goal: Characterization of a Eukaryotic Gene For the sake of organization (& fun), many of the exercises in the first ½ semester will simulate an actual research experience in which you will test the hypothesis that an unknown segment of DNA provided by the instructor encodes an essential eukaryotic gene. Flow Chart Isolate a "foreign" DNA molecule (gel purification of the "insert" DNA)  Create a recombinant DNA molecule (ligate the insert DNA to a plasmid vector; prepare competent cells and transform E. coli) Purify the recombinant DNA (plasmid DNA miniprep; restriction digests) Determine whether the cloned DNA contains a transcribed gene (RNA extraction from yeast; 32P labeled probe preparation by vitro transcription; northern hybridization with +/‑ sense probes) Establish the DNA sequence of the cloned gene (single stranded DNA preparation from virally infected cells; DNA sequence analysis) Demonstrate that the cloned DNA actually defines the gene detected by mRNA hybridization (yeast transformation; genetic complementation)

Second Half of Semester
Other experiments included in this half of the semester: Identify a genomic DNA polymorphism & inverse PCR as a mutagenesis tool; RNAi knockdown and phenotypic characterizations; purification of a recombinant protein (a previous year’s “design a lab” winner) Along the way, you will also learn other valuable techniques: RNAi disruption of gene expression; real time PCR; preparation of yeast genomic DNA; organic extraction of proteins; nucleic acid concentration by ethanol precipitation; gene cloning by insertional inactivation and selection; native agarose gel electrophoresis; denaturing agarose and denaturing polyacrylamide gel electrophoresis; probe fractionation & quantification; autoradiography; isolation of a recombinant protein by affinity selection; safe use of radionucleotides and lab equipment. Second Half of Semester Thematic Goal: Defining and testing hypotheses. The results of a recent “deep sequencing” study will be presented and used to develop a hypothesis concerning the existence of novel introns & alternative splice sites In addition, we will conduct a yeast two-hybrid (Y2H) experiment to map a protein-protein interaction domain in vivo, a chemical random mutagenesis experiment to generate loss-of-function mutations in lacZ, affinity purify a recombinant protein, do a western blot to visualize an epitope-tagged protein and use CRISPR-Cas9 to create gene-specific deletions in vivo.

Tentative Class Schedule (subject to change)
Aug. 23: Course overview; lab group assignments, gel electrophoresis, online safety training; basic lab technique. Chemical Hygiene Plan/Laboratory Safety Hazardous Waste Fire Extinguisher Biological Safety These online training sessions can be accessed at: Note: after logging in, select “8E300 Department of Biology” as the Department listing. You are required to provide a certificate for completion for each of these by the end of the second week of classes. You are not required to repeat a session previously completed for another course or for research lab training, just provide us with a copy of your training certificate. Submit proof of completion by 9/7/17 Friday, August 25: Historical perspectives on recombinant DNA technology & toolbox of enzymes Aug. 28: LAB 1. Agarose gel fractionation & purification of DNA; double restriction endonuclease digestion of vector DNA. Reading assignments: PDF files on Qiagen agarose gel recovery; New England Biolabs (NEB) catalog pages 16, (icon descriptions), 45 (HindIII-HF), 42 (EcoRI); 316 (High-Fidelity (HF) restriction enzymes; (alkaline phosphatase) 175 (Quick-load 1 kbp Extend DNA ladder; print out for your notebook), (restriction enzyme background), 359 (Getting Started with Molecular cloning), 367 (trouble shooting DNA purification).

Lab 1 Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. Today 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). Minor change in schedule: we will select the gel slice as stated but do the DNA elution (Qiagen) on Wednesday 2) Prepare the pTZ18/19u plasmids for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase.

Each Student (read the pdf file on the Qiagen QIAquick spin handbook – gel recovery section)
‑Mix 2 μl of dye (50% glycerol, 0.1% bromophenol blue, 0.1% xylene cyanol, 5X TAE) with 7.5 μl of your DNA digest in a clear microfuge tube. -Pipet 4.5 µl of this DNA/dye mixture carefully into two wells of your 1.25 % agarose gel. Run at 70 volts until the fast dye (bromophenol blue) migrates ½ to 3/4 the gel length. Be sure to check the CURRENT setting to be certain that the gel is running.

pTZ18u, pTZ19u– made for high copy DNA amplification, RNA transcription, ssDNA production.
IPTG X-gal The only difference between pTZ18u and pTZ19u is the orientation of the multiple cloning site with respect to the T7 RNA polymerase transcription site. 19u transcribes from HindIII to EcoRI and 18u transcribes from EcoRI to HindIII. Cloning in both vectors allows us to make both + and – strand RNA hybridization probes.

Each Student (groups 1-2 get pTZ18u and groups 3-4 get pTZ19u)
Digest your pTZ vector (18u or 19u) with EcoRI in a final volume of 25 μl; assemble: 9.5 μl sterile water 2.5 μl 10X CutSmart buffer (1X = 50mM Potassium Acetate, 20mM Tris-acetate, 10mM Magnesium Acetate, 100μg/ml BSA , pH 10 μl DNA (2 μg, ~ 1 picomole of 18u or 19u but not both) (Assemble reaction in this tube) 1 μl EcoRI (or 10 units; excess units because our lab time is short & you want to ensure a complete digestion) 1 μl HinDIII Vortex the sample very briefly (~2 seconds) and then spin briefly (~5 seconds – push the button). Note that the air/liquid interface (foaming) can denature proteins, so limit the amount of vortexing time and avoid conditions that cause foaming. ‑Incubate for 30min at 37oC. ‑Next, add 1 μl (0.3 unit) of NEB Quick CIP (calf alkaline phosphatase). Mix well then spin as before and then incubate at 37oC for 15 min.

‑Add 150 μl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8
‑Add 150 μl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), extract 1X with 150 μl of PCI (phenol/CHCl3/isoamyl alcohol in a ratio of 50:49:1 with the organic antioxidant 10 mM 8-hydroxyquinoline) by repeated vortexing over a 5 minute period. Spin the sample in the microfuge for 5 minutes at full speed. Be careful, this organic solvent mix can burn your skin. ‑Remove upper phase (aqueous, includes DNA) place into fresh microfuge tube. ‑Add 100 μl of 3M sodium acetate and 1 ml of 100% ethanol, vortex well. Label your tube with the date, your initials, and the experiment (i.e., pTZ18u E/H-SAP). Place in the -20 freezer until the next lab period. NOTE: In order for DNA or RNA precipitation to work, the sodium acetate and ethanol must be mixed well with your sample. phenol chloroform 8-hydroxyquinoline

With gloved hands remove the gel by lifting the glass or plastic slide (not the gel) on which it rests. Place the gel in the 2.0 μg/ml ethidium bromide solution. Ethidium bromide is mutagenic and a suspected carcinogen, take care not to get it on your skin. Go to our class web site to find information the structure of ethidium bromide and safe handling procedures. Also, read PGMG pages 16-17, 56. IMPORTANT NOTE: To avoid microbial and nuclease contamination of your sample, close the lid of the pipet tip box after each use. ‑After 15 minutes in the EtBr stain remove the gel and rinse it briefly with water. ‑Place the gel on the UV transilluminator to visualize the DNA bands. Two sharp bans should be visible (and perhaps a third, fuzzy one near the bottom of the gel). NOTE: To avoid a strong burn to skin and eyes, always wear a face shield when using the UV transilluminator. ‑Excise the second band from the top (i.e., well side) of the gel with the plastic knives. Work as quickly possible since the UV light damages the DNA in your sample (and in your skin). Limit the amount of excess gel (that is gel that borders but does not contain DNA) as excess gel reduces you DNA yield.

This dye intercalates into ds DNA – what does this mean?
Ethidium bromide This dye intercalates into ds DNA – what does this mean? What happens to the properties of ethidium bromide after it intercalates?

STOP HERE – we will complete the recovery on WEDNESDAY
‑Weigh the gel slice on pan balance after using an empty tube to TARE (that is, set to zero) the scale – as this is mostly water, assume 100 mg is roughly 100 µl of gel volume. STOP HERE – we will complete the recovery on WEDNESDAY VERY IMPORTANT: Label your tube with: Today’s date (8/27/18) your group number & your initials, and a description of its contents (e.g., 8/28/17, Gp1- BR, “insert” DNA).

Aug. 29: LAB 2. Reading assignments (completed before lab meets): PDF files on pTZ19u map (print out for your notebook); SYBR safe (posted); NEB (Online Interactive Tools); (basic restriction enzyme use); 275 & 347 (methylation); Principles of Gene Manipulation & Genomics (PGMG) chapters 1-3 and Box 15.1 on pages

Running list of experiments
Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. TODAY 3) Recover EcoRI/HindIII cut & CIP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this “vector” DNA and the recovered yeast “insert” DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. 2) Recover gel-fractionated yeast genomic DNA fragment from agarose using Qiagen kit 4) Prepare E. coli cells competent for DNA transformation by CaCl2 treatment; cryopreserve the competent cells (we will do this first) Bonus: Comparing the sensitivity of EtBr and SYBR Safe for staining DNA in gels (assisted demonstration)

For Each Group ‑‑Spin the 40 ml of the TG1 E. coli culture for 10 min. at 5,000 rpm (done just before class) ‑Pour off the broth (one quick move) and gently resuspend (no vortexing) the pellet in 20 ml of ice buffered cold calcium chloride solution (100 mM CaCl2, 10 mM PIPES (pH 7.0)). Incubate on ice for 1 to 2 hours -Invert the tube every 15 minutes to keep the cells from settling. ‑Spin out the culture at 5,000 for 5 min. ‑Pour off the supernatant and resuspend the pellet in 3 ml of ice cold calcium chloride Pipes solution adjusted to contain 15% glycerol. Gently but completely mix again (the glycerol takes a bit of effort to mix in). Mix well and make sure all clumps are dissolved. ‑Place the cells in the dry ice container at the front of the room. The cells will be kept in a freezer at ‑85oC until the next lab meeting.

Each Lab Member ‑Spin your microfuge tubes containing the (pTZ18u or 19u) plasmid vector DNA + ethanol in the microfuge for 5 minutes on the highest speed setting. ‑Carefully remove the supernatant (i.e., the liquid) using a sterile 1 ml pipet tip. It is important to remove the ethanol without disturbing your pellet. Leave no more than 30 μl behind (to see what 30 μl "looks like" pipet this volume of liquid into a fresh tube (a tube with nothing in it). Mark the top of the meniscus with your magic marker for future reference). ‑Add 1 ml of fresh 80% ethanol to the DNA pellets. Mix briefly and then spin for 2 min. in the microfuge. Note: the precipitated DNA will not re-dissolve in the 80% ethanol “wash” – so don’t worry about using the vortex to mix.

‑ Remove the supernatant
‑ Remove the supernatant. As before, add 1 ml of fresh 80% ethanol to the pellet, and spin again for 2 minutes. The 80% ethanol “wash” steps make sure that remove all salt from the preparation which might inhibit the subsequent enzymatic steps. ‑Remove the ethanol with the P1000 then use the P20 to remove as much additional ethanol as possible. -Place your tubes into the Speed-vac vacuum dryer (this is really three machines, a centrifuge, a vacuum pump, and a refrigerated vapor trap). The TA will inspect your tube before placement into the Speed-vac to confirm that most of the ethanol has been removed. ‑When the samples have dried (~20 minutes depending upon how much ethanol was in your sample), resuspend the EcoRI/HinDIII/SAP- treated vector pellet in 20 μl of sterile water. The pellet may not be visible – don’t worry, the DNA is there.

To the gel slice: Add three volumes of QG buffer (6M guanidine isothiocyanate, 50 mM Tris, 150 mM NaOAc, 20 mM EDTA pH 5) to the gel slice. EXAMPLE: if your gel slice weights 325 mg, add 3X 325 or 975 µl of QG. Let me know if the calculated volume is greater than 1 ml. Incubate for 15 minutes at 55C in the appropriate dry block heater. (Vortex briefly at 10 minutes, then replace at 55C)

Bind DNA to the column, wash off impurities, elute DNA
Dissolve & bind in QC (6M guanidine isothiocyanate, 50 mM Tris, 150 mM NaOAc, 20 mM EDTA pH 5 –WHY is pH relevant?), Wash in PE (80% ethanol in 10 mM Tris, pH 7.5) and Elute in EB (10 mM Tris, pH 8.5) Chaotropic salts such as 6M guanidinium isothiocyanate (QC) interfere with the hydrogen bonding structure of water and increase the solubility of nonpolar compounds (purine & pyrimidine bases) in aqueous (i.e., water rich) environments and promotes binding of DNA to silica.. The organic ethanol solution (PE) rinses away the QC but the DNA is retained on the silica. Release of DNA occurs in low salt/higher PH aqueous solution (EB – or 10 mM Tris, pH 8) due to charge repulsion between DNA and silica resin (in essence, finely ground glass).

Bind DNA to silica in high salt and low pH; release DNA in low salt aqueous solution above pH7.5
The low pH keeps ionizable groups on bases protonated and high salt shields against charge repulsion between the negatively charged silica oxide and the negatively charged DNA phosphate backbone.

Binding is to the matrix is strongly pH dependent; pH must be less than 7.5 to bind the resin. To be sure your pH is in the acceptable range, add 5 μl 3M NaOAc (pH 5.0) and mix on the vortex. Add 1 gel volume amount (NOT gel volume plus QG) of isopropanol. Vortex. Put a QIAquick (Qiagen) spin column (containing a silica-based gel resin) in a 2 ml collection tube. Add DNA to the column, incubate for 1 minute at room temperature then spin for 1 minute in a microfuge at full speed. DISCARD the flow-through. NOTE: The columns can hold only 700 μl. If you have more volume than 700 μl simply reload the column with the additional liquid after the first spin. Add 0.5 ml of QG to column, spin 1 minute as before. Discard the flow-through.

Add 0. 75 ml of PE wash buffer (80% ethanol in 10 mM Tris, pH 7
Add 0.75 ml of PE wash buffer (80% ethanol in 10 mM Tris, pH 7.5), allow to sit at room temperature for 1 minute then spin for 1 minute as before, and discard the flow through. Spin again for an additional 1 minute to remove all residual liquid. Place the column in a new clean 1.5 ml microfuge tube. Add 50 μl of elution buffer (EB 10 mM Tris, pH 8.5) pre-warmed to 55C to your column (directly over sample), INCUBATE at room temperature for 1 minute. All suggested in the Qiagen protocol, substitution of water for EB is NOT recommended as the pH difference can lower recovery. Spin 1 minute. Your DNA is now ready for ligation; store at -20C until use.

Gel loading order: Student gel lane sample
‑ In a fresh tube, mix 2 µl of dye with 2 µl of your cut vector and, in second tube, 2 µl dye with 4 μl of your purified insert DNA. Do not add dye to your stock tube of purified DNA. Load all of each DNA/dye sample on the pre‑poured 1% agarose gel. In addition to your insert & cut vector, each gel should include 1 µl of uncut plasmid DNA (pTZ18u or 19u plus add 1µl of dye) and 4 µl of the DNA molecular weight markers (dye already added, don’t add more). Run at 70 volts (remember to check the amperage) Gel loading order: Student gel lane sample 1 1 uncut plasmid vector (pTZ18u or pTZ19u) 1 2 Eco/HindIII cut vector 1 3 recovered yeast insert DNA from gel 1 4 DNA molecular weight marker 2 5 uncut plasmid vector 2 6 Eco/HindIII cut vector 2 7 recovered yeast insert DNA from gel

Start of run __________ volts; __________ milliamps
End of run ___________ volts; __________milliamps What parameter changed during electrophoresis? What might have caused this change? ‑Stain the gel and photograph alongside a fluorescent ruler (the T.A. will help but each group should take its own photo). ‑Create a standard curve by graphing the migration (in cm) of the DNA size standards against the log of their lengths. Use semi‑log paper, the X-axis (non‑log) is for the distance value, the Y-axis (log) is for the DNA lengths in kilo base pairs. Note that since the Y-axis is graphed on log paper you simply graph the numerical value of the DNA lengths (e.g., 1.0 = 100 bp in first log set). Include this graph in your notebook. A blank copy of semi-log paper is on the class web site & also at the back of this lab manual.

Homework due no later than 5:00 PM today (email to me is fine)
Monday – final (final) day to turn in safety training confirmation. Short quiz on Monday – look at Canvas site for an example of quiz length, question type, etc. Due Date* Assignment 9/5/18 Required Communication between scientists is key to moving the discipline forward. Participate in current science literacy: Subscribe to the Scientist Magazine (( Also sign up for the online weekly updates during the registration. Get full credit by providing me with printout of online confirmation of your free online subscriptions. This subscription is for your interest & benefit – you will not be tested on this materials. 10 pts Homework 2 due in one week - 9/12/18 Continue collecting in the Q&A participation points – remember almost any science question/answer qualifies.

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA insert band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). 2) Prepare the pTZ18/19u plasmid vectors for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase. 3) Recover EcoRI/HindIII cut & CIP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this vector DNA and the recovered yeast insert DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. TODAY 5) Create the recombinant DNA molecule by directional cloning via ligation of EcoRI/HindIII cut plasmid vector (pTZ18u/19u) & yeast DNA insert. 6) Isolate yeast RNA to be used for the identification of cellular RNA transcripts originating from your yeast DNA insert. Bonus: Determine the influence of DNA buffer concentration on the mobility of linear and circular forms of ds DNA; EtBr vs SyBr Safe DNA stain

1kbp markers (fastest band shown is 0.5 kbp)
We ran 2 µl of cut vector DNA and 4 µl of insert DNA. Here I would adjust of reaction conditions to 1 µl vector, 8 µl insert Gp3 results Uncut pTZ19u E/H/Cip-19u “insert DNA” 1kbp markers (fastest band shown is 0.5 kbp) I will speak with each group to let you know how much insert and vector to use. NOTE: If you cannot see the insert on your gel – pencil in a band at the equivalent position to determine insert size.

Joining DNA Ends with DNA Ligase Each Lab Member. IMPORTANT NOTE: The volumes of vector and insert DNA used in this step may need to be altered depending on efficiency your DNA recovery so be sure to show the photograph of your gel to the instructor or T.A. before continuing. To increase the frequency of the bi-molecular ligation, we will use approximately 4X the molar amount of insert to vector. The insert is roughly 1/4 the length of the vector, so equal mass amounts of DNA (equivalent EtBr intensity bands) will give ~4X the molar amount of insert to vector. See pages in PGMG. Assemble the following 20 μl reaction in the following order: 10 μl of sterile water (or sufficient water have a final reaction volume of 20 μl 2 μl of 10X ligase buffer* 2 μl (or as directed by the T.A.) of the pTZ18 or 19u Hind/Eco cut vector 5 μl (or as directed by the T.A.) of isolated gel fragment (i.e., insert DNA) Mix briefly, then add: 1 μl (1 to 2.5 units) of T4 DNA ligase. Mix briefly. ‑Each student should also set up a second, control ligation reaction as above but with additional water instead of insert DNA. This control will score the amount of vector self-ligation. LABEL THE TUBES WELL (e.g., Gp 1, BR control lig.). Incubate the ligation reaction overnight on the bench at room temperature

Small‑scale Preparation of RNA from Yeast Cultures (Each Student)
Small‑scale Preparation of RNA from Yeast Cultures (Each Student). DNA is a double stranded molecule. Enzymatic single-stranded RNA synthesis is always produced 5’->3’, with new nucleotides being added to the reducing end (i.e., 3’ hydroxyl) of the growing RNA chain; the DNA template is present in an anti-parallel orientation. Any given gene may be transcribed from either the "top" (or Watson) strand or the "bottom" (or Crick) strand but not both. So, a given mRNA is complementary in sequence to one strand of the double-stranded gene and identical in sequence to the other DNA strand. We will extract natural RNA from the simple eukaryote, Saccharomyces cerevisiae (baker's yeast), to learn the direction of transcription of our cloned gene (in essence, to learn which strand of DNA is transcribed). Since the entire genomic sequence of S. cerevisiae is known, the orientation of transcription can be used with bioinformatic tools to reveal the amino acid sequence of protein coding genes or the functional RNA features for non-protein coding genes (e.g., tRNAs, rRNAs, snoRNAs, snRNAs, etc.). The stock name of the yeast strain we will use is BY Its genotype is: MAT α (alpha) his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0 (the nomenclature lists the sex of the strain (MAT alpha) and mutations in genes required for the biosynthesis of histidine leucine, lysine, and uracil. NOTE: Ribonuclease is everywhere (e.g., saliva)! Wear gloves throughout this procedure. 1. Grow yeast to saturation in 5 ml of YPD 30oC (12‑24 hr., depending on the inoculation and how "healthy" the strain is). 2. Dilute culture 1/10 in fresh YPD and grow at 30C with shaking for 5 hours prior to use. NOTE: growth sensitive mRNAs are best recovered from cultures of O.D. 600nm of 0.4 to 0.6 as such genes can be transcriptionally repressed at high cell densities.

4. Spin out 1.5 of yeast culture (1 min at full speed in the microfuge) in a 2 ml screw cap tube and wash once with 1-ml ice cold RE buffer (100 mM LiCl, 100 mM Tris‑HCl pH 7.5, 1 mM EDTA). To “wash”, simply add the RE, vortex to mix well, and spin again (as above) to re-pellet the cells. Resuspend the cell pellet in 0.4 ml of cold RE buffer and 150 μl of Tris‑buffered phenol/CHCl3/isoamyl alcohol (PCI, 50:49:1). 5. Yeast have a very strong cell wall, you will beak the cells by mechanical grinding with glass beads. Add approximately ~2/3 of the cell suspension volume of sterile glass beads (acid washed and siliconized). CRITICAL NOTE: Be sure that there are NO GLASS BEADS on the lip of the microfuge tube before capping since the glass will cause leakage of the caustic phenol and sample loss Break cells using the vortex mixer, 8 X 30 seconds on high speed (place on ice for 30 seconds between vortexing to keep the solution cold). To reduce cleavage by endogenous nucleases (that is, to improve the quality of the RNA sample). WORK QUICKLY though the cell breakage step. 6. Spin the sample 3 minutes at full speed in the microfuge and transfer the entire upper layer to a fresh standard microfuge tube with 300 μl of PCI. Vortex over a 3 min. period. Spin for 2 min. in the microfuge. Remove the entire upper (aqueous) layer and extract third time with 200 μl phenol/CHCl3/isoamyl alcohol. Finally, extract the aqueous layer one last time with 100 μl chloroform only. The extra chloroform step removes any residual and, like the PCI, the chloroform layer sinks to the bottom of the tube.

7. Transfer the upper (i.e., aqueous) phase to a fresh tube and add 100 μl of 3 M sodium acetate (pH ~ 5.5) and 1 ml of 100% ethanol. Vortex well and then place on dry ice for 10 minutes. 8. Thaw, vortex and then spin in a microfuge for 8 min., decant (discard) all the supernatant, and with 1.0 ml 80% ethanol. Spin 2 min., decant the ethanol by pipet; wash the pellet a second time with 1.0 ml of 80% ethanol, spin 2 minutes, remove the ethanol and the dry the pellet under vacuum. 9. Resuspend the nucleic acid pellet in 25 μl of sterile H2O – LABEL WELL (e.g., Gp1, BR RNA) and put in dry ice at the front of the room. 10. Store the RNA sample at ‑80oC until used. The typical yield is 20‑40 μg of total RNA (of which ~ 95% is rRNA and tRNA).

Phenol – solubilizes certain proteins & lipids if present
TE-saturated PCI (phenol/CHCl3/isoamyl alcohol in a ratio of 50:49:1 with the organic antioxidant 10 mM 8-hydroxyquinoline) - extract proteins by repeated vortexing over a 5 minute period. Be careful, this organic solvent mix can burn your skin. Always save the upper phase (aqueous, includes DNA) place into fresh microfuge tube. Phenol – solubilizes certain proteins & lipids if present Chloroform – denatures (unfolds) proteins (pulls phenol our of aqueous) Isoamyl alcohol – helps form a sharp interface between aqueous and organic layers Proteins partition either in the organic layer or in the interface between the organic & aqueous layers phenol chloroform 8-hydroxyquinoline

Two student assisted demonstrations:
Ethidium bromide vs SYBR safe (Assisted Demonstration). Ethidium bromide (EtBr) is a very sensitive compound for the detection of DNA. Unfortunately, EtBr is also a strong mutagen and a potential carcinogen. Invitrogen sells a safer alternative DNA dye, called SYBER safe (product description on the class web site). Today we will compare evaluate both EtBr and SYBER safe for sensitivity. One student will do a series of 5-fold dilutions of the NEB 1Kb extend DNA ladder, load adjacent lanes of a gel as: 2 µl (undiluted), 2 µl (1:5 dilution), 2 µl (1:25 dilution), 2 µl (1:125 dilution) Followed by 2 empty lanes then After the run is complete, the gels will be cut in half and stained either with EtBr at 2 µg/ ml or the recommended dilution of SYBR safe. We will photograph each gel with filters compatible for the two dyes. The signal intensities will then be compared to test the vendor’s claim that SYBR safe is as sensitive as EtBr.

Impact of increased buffer concentration on DNA migration (assisted demonstration). As mentioned in Lab 2 many factors influence the electrophoretic mobility of nucleic acids. Today we will determine how buffer strength influences the mobility of linear, open circle, and supercoiled DNAs. Three gels will be set up and run with equivalent amounts of DNA at the same voltage and for the same length of time. Gel 1 will be run as a standard 1X TAE gel, gel 2 with 1/3X TAE and gel 3 with 3X TAE. The gels will be loaded as: Lane 1 - linearized pTZ18u Lane 2 – NEB 1 kbp extend DNA ladder Lane 3 - uncut pTZ18u (the TA will tell you how much of each to load) Assume that no change occurs in the pH (which it won’t under the conditions of use), the mobility difference can be thought of as due to decreased or increased Tris-acetate salt concentration.

This dye intercalates into ds DNA – what does this mean?
Ethidium bromide This dye intercalates into ds DNA – what does this mean? What happens to the properties of ethidium bromide after it intercalates?

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). 2) Prepare the pTZ18/19u plasmids for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase. 3) Recover EcoRI/HindIII cut & SAP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this “vector” DNA and the recovered yeast “insert” DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. 4) Prepare E. coli cells competent for DNA transformation by CaCl2 treatment; cryopreserve the competent cells. Bonus: Comparing the sensitivity of EtBr and SYBR Safe for staining DNA in gels. 5) Create the recombinant DNA molecule by directional cloning via ligation of EcoRI/HindIII cut plasmid vector (pTZ18u/19u) & yeast DNA insert. 6) Isolate yeast RNA to be used for the identification of cellular RNA transcripts originating from your yeast DNA insert. Bonus: Determine the influence of DNA buffer concentration on the mobility of linear and circular forms of ds DNA TODAY 7. Transform your competent E. coli with your experimental & control ligation reactions. Select transformants on LB-ampicillin plates and score putative recombinant transformants as β galactosidase deficient using IPTG/Xgal medium 8. Determine yeast mRNA yield & prep 15 µg for your northern blot 9. Short Quiz & review notebooks

pTZ18u, pTZ19u– made for high copy DNA amplification, RNA transcription, ssDNA production.
Cloning your yeast DNA fragment into the MCS inactivates the lacZ gene – such colonies do not produce beta galactosidase. IPTG X-gal The only difference between pTZ18u and pTZ19u is the orientation of the multiple cloning site with respect to the T7 RNA polymerase promoter (transcription initiation). 19u transcribes RNA from HindIII to EcoRI and 18u transcribes from EcoRI to HindIII. Cloning in both vectors allows us to make both + and – strand RNA hybridization probes.

Before plating, we will add IPTG to induce transcription of the lac promoter upstream of our cloning site IPTG stimulates transcription by binding to the lac repressor protein causing lac repressor to be released from the DNA operator site and allowing the RNA polymerase to bind the promoter sequence and transcribe the gene.

We will also add the chromogenic substrate, X-gal to the medium.
E. coli in which the lacZ gene is transcribed produce β-galactosidase which cleaves X-gal to produce a blue compound.

All colonies – blue and white are transformants since only cells containing a plasmid grow on ampicillin (due to expression of the plasmid borne β lactamase gene) Blue colonies produce b –galactosidase and retain intact lacZ gene and likely represent the starting (unmodified) pTZ18u/19u. While colonies from the experimental plate are candidates for having recombinant plasmids with the “insert” DNA disrupting and inactivating lacZ β-lactamase is secreted from E. coli and cleaves the β-lactam ring of ampicillin, locally destroying the drug.

E. coli Transformation (each student)
The transformation protocol promotes the movement of DNA present in your ligation reaction into the E. coli cells. The plasmid DNA will then replicate in the bacteria to reach an amplified copy number of 500-1,000 molecules per cell. An underlying assumption of this technique is that each colony formed grows from a single transformed with one (and only one) plasmid DNA molecule from the ligation mixture.

‑Mix 500 μl of competent E. coli with 5 μl of your experimental ligation (i.e., vector + insert) in the capped glass tubes provided (label this tube EXPERIMENTAL LIGATION, include your initials). In a second tube do the same for your CONTROL LIGATION (i.e., vector only). ‑Incubate the cell/DNA mixture on ice for 30 min. ‑Transfer the tube to the 42oC water bath for exactly 60 seconds (timing is very important during this step). Be sure that the water bath is correctly set at 42oC before incubating your cultures since 42C is close to the upper limit for E. coli cell viability. -Place culture on ice for 2 minutes ‑Add 2 ml of 2XYT broth. Incubate at 37oC with vigorous shaking for 45 min. Why do you want to be sure that no antibiotics are present at this step? Answer this in your notebook but do not turn in for grading. -During this 45-min incubation spread 20 μl of 100 mM IPTG and 50 μl of 2% X‑gal solution on 6 LB‑amp (containing 150 μg/ml ampicillin) plates. Spread the chemicals quickly and evenly, don't pool the solution in one position on the plate. This is very important and improper spreading of the X-gal/IPTG is the #1 cause of problems with this experiment.

‑After the 45 min incubation pipette 20 μl of the experimental ligation culture onto an LB‑amp/IPTG/X‑gal plate labeled EXPERIMENTAL LIGATION, 20 μl, today’s date, student initials. Plate 200 μl of the experimental ligation culture on a second plate labeled the same (except substituting 200 μl for 20 μl). Finally, spin the remaining cells for 10 minutes in the centrifuge, pour off the culture medium, and plate the pellet on a third plate (roughly 1835 μl culture). Do the same for the control ligation culture on three fresh plates (6 plates total per student). IMPORTANT NOTE : Be sure to sterilize your spreader before each plating.

We ran 2 µl of cut vector DNA and 4 µl of insert DNA
We ran 2 µl of cut vector DNA and 4 µl of insert DNA. Here I would adjust of ligase conditions to 1 µl vector, 8 µl insert (left side)

‑Create a standard curve by graphing the migration (in cm) of the DNA size standards against the log of their lengths. Use semi‑log paper, the X-axis (linear) is for the distance value in cm. The Y-axis (log) is for the DNA lengths in base pairs X Note that since the Y-axis is graphed on log paper you simply graph the numerical value of the DNA lengths (e.g., 1.0 = 100 bp in first log set). Include this graph in your notebook. A blank copy of semi-log paper is on the class web site & also at the back of this lab manual.

What is the length of your “linear vector” DNA?
What is the length of your yeast genomic DNA “insert”?

Ethidium bromide vs SYBR safe (Assisted Demonstration)
Ethidium bromide vs SYBR safe (Assisted Demonstration). Ethidium bromide (EtBr) is a very sensitive compound for the detection of DNA. Unfortunately, EtBr is also a strong mutagen and a possible carcinogen. Invitrogen sells a safer alternative DNA dye, called SYBER safe (product description on the class web site). Today we will compare evaluate both EtBr and SYBER safe for sensitivity. One student will do a series of 5-fold dilutions of the 1Kb+ DNA preparation, load adjacent lanes of a gel as: 2 µl (undiluted), 2 µl (1:5 dilution), 2 µl (1:25 dilution), followed by 2 empty lanes then Q? What is the difference between a mutagen and a carcinogen?

Cost per standard mini-gel
EtBr (purchased as powder): $0.0037/gel SYBR Safe (purchased as liquid concentrate):$2.45/gel SYBR safe is roughly 662 X more expensive to use when considering only the initial product cost (does not consider the possibility of re-using the solutions, possible different costs of disposal, etc.) Other issues? Safety, sensitivity, stability, equipment Which would you purchase for your lab?

Quantifying RNA – don’t touch the microfuge tubes unless you have gloves on.
The spectrophotometer is used in this experiment to acquire an estimate of your RNA yield and quality. You will read your sample both at the wavelength for which RNA absorbs maximally (260 nm) and a peak of protein absorbance (280 nm) to determine these values. 1. Thaw your RNA samples and vortex vigorously. 2. Spin 15 seconds in the microfuge. 3. Transfer 5 μl of the supernatant to 1 ml of sterile water. Immediately place the remaining RNA sample on ice. 4. Read the A260 and A280 on your sample in a spectrophotometer. 5. A 1 mg/ml solution of RNA in a 1 cm path will read A260. Multiply your A260 value by 200 (dilution factor) then divide by 25 (the extinction coefficient) to get the concentration of your RNA in units of mg/ml (same as µg/µl) . A typical yield is 1-2 µg/µl. 6. The A260/A280 ratio for RNA is ~1.9‑2.0. Values lower than this suggests protein contamination; greater values likely are due to phenol contamination. 7. Transfer 15 µg of RNA to a clean microfuge tube (any RNA in excess of the required 15 µg should be stored in your freezer boxes). Label the tube (Group, initials, RNA) containing the 15 µg of RNA and bring it to the front of the room. This 15 µg RNA sample will be dried and stored at -80C until the NEXT LAB PERIOD for resuspension in the denaturing loading buffer. Here is a link to multiple programs for RNA structure prediction, modification, function, and related topics:

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). 2) Prepare the pTZ18/19u plasmids for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase. 3) Recover EcoRI/HindIII cut & SAP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this “vector” DNA and the recovered yeast “insert” DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. 4) Prepare E. coli cells competent for DNA transformation by CaCl2 treatment; cryopreserve the competent cells. Bonus: Comparing the sensitivity of EtBr and SYBR Safe for staining DNA in gels. 5) Create the recombinant DNA molecule by directional cloning via ligation of EcoRI/HindIII cut plasmid vector (pTZ18u/19u) & yeast DNA insert. 6) Isolate yeast RNA to be used for the identification of cellular RNA transcripts originating from your yeast DNA insert. Bonus: Determine the influence of DNA buffer concentration on the mobility of linear and circular forms of ds DNA 7. Transform your competent E. coli with your experimental & control ligation reactions. Select transformants on LB-ampicillin plates and score putative recombinant transformants as β galactosidase deficient with IPTG/Xgal. 8. Determine yeast mRNA yield & prep 15 µg for your northern blot TODAY 9. Resolve yeast total cellular RNA (nuclear, cytoplasmic, mitochondrial, poly A+/-) by denaturing gel electrophoresis (1% agarose, formaldehyde gel run in MOPS buffer). Transfer to positively charged nylon membrane (Millipore Immobilon NY+). 10. Count blue & white colonies & patch single isolates from your experimental (pTZ18/19u + insert) and control (pTZ18/19u only) transformations.

Formaldehyde Northern Blot (Each Student) NOTE: Wear gloves throughout this procedure. A northern blot is one means to analyze RNA – others common techniques include reverse transcriptase PCR (rtPCR) and mRNA sequencing. We will also do rtPCR later in the semester and use this to validate mRNA results obtained by RNA sequencing. Here you will first resolve the RNA molecules present in your yeast nucleic acid sample based on relative lengths. All RNAs have equivalent charge/mass ratios yet larger RNAs move more slowly due to the frictional barrier presented by the agarose matrix (assuming RNA secondary structures are melted). 1. Add 10 μl of the RNA denaturation solution to each dry RNA sample. The solution was prepared by mixing 5X MOPS buffer [0.1 M 3‑[N‑morpholino]propanesulfonic acid); 40 mM sodium acetate; 5 mM EDTA, pH 7.0], formaldehyde, formamide in a 1:1.75:5 ratio, and 400 ng of ethidium bromide. 3. Vortex the RNA sample vigorously several times over a 5 min. period. Spin the sample in the microfuge briefly to collect the liquid at the bottom of the tube. Incubate the sample at 65oC for 10 min. and then place on ice for 2 min. Be sure that you use the correct (i.e., 65oC) incubator. 5. Add 2 μl of tracking dye (50% glycerol, 1 mM EDTA, 0.1% BPB/XC) to your sample. Mix well. 6. Load 4 μl of your sample into well #1 of your 1% agarose/formaldehyde. Your bench mate should load his/her 4 μl sample in well #2. Skip (leave empty) wells #3,4,5 and then reload 4 μl your sample into lane 6 (your bench mate will add his/hers to lane 7). Record the order of student loading in your notebook. 7. Run the gel at 55 volts (HIGHER voltages will greatly distort the sample migration) in 1X MOPS buffer until the tracking dye is near the bottom of the gel (at least 3/4th the length).

What’s in your RNA sample buffer & gel?
Formamide: lowers the melting temperature of intra or intermolecular base pairing by competing for hydrogen bonds with base pairs – the RNA double helical structure denatures at a lower temperature Formaldehyde: covalently modifies the RNA purine and pyrimidine bases to prevent re-annealing of denatured structures during the running of the gel. Post –gel transfer conditions of membrane reverses this modification to allow probe to bind. MOPS: biological buffer that works well ~ pH 7.0

EDTA: inhibits nucleases dependent on Divalent cations (such as Mg++)
EDTA: inhibits nucleases dependent on Divalent cations (such as Mg++) Sodium acetate: simple salt to dissolve the RNA sample and facilitate electrophoresis EtBr: added to loading dye to stain RNA, this tracks with the RNA during electrophoresis and transfers to the membrane allowing us to image the rRNA bands. Ethidium bromide

Gel images – TAE concentrations (posted image) 1/3X 1X 3X
How do the linear plasmid DNA bands migrate at each salt concentration? Faster or slower with increasing salt? Hint – look at the smallest DNA ladder (marker) band. How do the supercoiled & circular DNA bands migrate with respect to the linear DNA makers at each salt concentration? WHY might buffer/salt concentration change overall DNA mobility? Why might alternative topological forms of DNA behave differently in response to buffer/salt changes? Lane 1: linear vector Lane 2: 1kb ladder (linear) Lane 3: uncut vector

Basics of Gel Electric Circuits
Amperage (amps for short) is a measure of electrical current the AMOUNT of electricity flowing. Voltage (volts) measures the pressure, or FORCE, of electricity. Current (amps) multiplied by the volts gives you the wattage (watts), a measure POWER or the work that electricity does per second. V (volts) = I (amperes) X R (resistance; measured in ohms.) I (current; amperes) = V (voltage; volts)/R (resistance; ohms) For a segment of a gel/buffer system  cross-sectional area of buffer or gel,  resistance and increase in current  strength of buffer = [ion],  resistance and increase in current

Where does the current come from?
Ions supplied by the buffer The charge on the macromolecules being separated Electrolysis of water self-ionization of water throughout the buffer: 4H20  4H+ + 4OH- At the negative pole (cathode) (electron flow out of negative pole) 4H+ + 4e-  2H2 At the positive pole (anode) 4OH-  O2 + 2H2O + 4e- End result: 4H2O  2H2 + O2 + 2H2O At which electrode would you expect more bubbles? Why?

You probably noticed that there were twice as many bubbles on the black pole (the cathode, close to the wells) than on the red pole (the anode, close to the end of the gel). These bubbles are hydrogen (cathode) and oxygen (anode) gas resulting from the electrolysis of water: 2H2O --> 2H2 + O2 As you can see, twice as many molecules of hydrogen than oxygen are produced per molecule of water. At room temperature, these gases behave nearly ideally (i.e. PV=nRT), so the volume of gas is directly proportional to its amount. In other words, the hydrogen gas produced has twice the volume, and therefore gives twice as many bubbles! Now, you may also be wondering why hydrogen is created at the cathode and not at the anode. Well, by definition, the cathode is negatively charged, so that electrons are flowing out of the black pole. Water can accept these electrons as follows: 4H2O + 4e- --> 4H2 + 4OH- Note that hydrogen gas is produced, not oxygen. At the positively charged anode, electrons are pulled from the hydroxide (OH-) produced above according to the following half-reaction: 4OH- --> O2 + 2H2O + 4e-

Lab 2 observations Start of run __________ volts; __________ milliamps
End of run ___________ volts; __________milliamps What parameter changed during electrophoresis? What might have caused this change?

All colonies – blue and white are transformants since only cells containing a plasmid grow on ampicillin (due to expression of the plasmid borne β lactamase gene) Blue colonies produce b –galactosidase and retain intact lacZ gene and likely represent the starting (unmodified) pTZ18u/19u. White colonies from the experimental plate are candidates for having recombinant plasmids with the “insert” DNA disrupting and inactivating lacZ

Satellite colonies are small colonies of non-transformed E
Satellite colonies are small colonies of non-transformed E. coli that surround an authentic plasmid transformant. Satellite colonies form when the local ampicillin concentration drops below a bacteriostatic level due to the b lactamase secreted by the large transformed cell. Satellite colonies are not transformants and do not have a drug-resistant plasmid and will not grow if re-streaked on a fresh ampicillin plate. Do not include the satellite colonies as “white” colonies on today’s plates.

LAB 5 E. coli plasmid transformation results Begin by counting and recording in your notebook the number of blue and white colonies on each plate. Assume that approximately 0.1 μg of ligated vector DNA was used for entire transformation (that is, 0.1 μg of DNA was mixed with the 500 μl of competent E. coli - remember, you increased this volume by 2 ml prior to plating (so, 0.1 μg of DNA in a total volume = = ml) Each plate only receives only a fraction of the total transformation mixture – for instance, the 20 μl plate has 0.1 X 0.02/2.505 μg of DNA. IMPORTANT NOTE: If you had no transformants on your plates, use another group’s data to answer the questions in your lab manual:

What was your transformation efficiency (the number of transformants per microgram of vector DNA)?
You can based this calculation on a single plate if you have one that has between colonies. State the dilution factor and number of colonies on the plate that you use for this calculation. For instance, if the 20 ul plate has ug vector DNA (last page) and 276 colonies, the transformation efficiency is: 276/ = 349,367 transformants per microgram of vector DNA

Preparation of E. coli Plate Cultures
‑Each student should use sterile toothpicks to patch two colonies on an LB-ampicillin plate, a white colony from the experimental plate and a blue colony (from either the experimental or control ligation plates). Note: no IPTG/X‑gal need be added to the plate. Use one LB-amp plate per group and divide this into four sections by marking the back with a Sharpie marker. Be sure to label your quadrants with your initials and each plate with your group number (e.g., group 1, GR, TY, EE) and either Blue or White. NOTE: Leave 1/4 inch open on each side of each patch to avoid cross-contamination between the cultures. Each student should label a sterile glass test tube similar to the plate designation. The TA will use your plates/tubes to start liquid cultures in these test tubes before next lab period.

8. Soak the gel 1 X 5 min. in 50 ml of water – gets rid of much of the formaldehyde (inhibits subsequent RNA-RNA hybridization) 9. Soak the gel 1 X 10 min. in 50 ml of 10X SSC (1.5M NaCl, 0.15M Na citrate, pH 7.0) – salt promotes binding to transfer membrane 10. Prepare blotting membrane: first use a pen to label the bottom right corner of the membrane with your group number, wet the membrane briefly (30 sec) in water then 2 minutes in 10XSSC), 11. Set up the gel transfer by stacking in the following order (from bottom to top): Plastic wrap sheet, blotting paper saturated with 10X SSC, gel (well side facing down, why? – answer in your notebook), Positively charged nylon membrane, blotting paper soaked in 10X SSC, dry blot paper, 2 inch stack of paper towels. 12. Use a syringe needle to stab a hole in the position of each well. In order for the transfer to work, the SSC in the gel must be drawn upward by capillary action through the charged nylon membrane. Air bubbles trapped between the gel and the filter membrane inhibit this process. To remove any bubbles, roll a Pasteur pipette over the gel surface and over the membrane and the next two layers of filter paper. 13. Tomorrow, the TA will 1) photograph, 2) UV crosslink and 3) bake your membrane tomorrow. The membranes will be stored dry at -20 until needed.

We will put Saran wrap on bench with a SSC-wet Whatman paper beneath
NORTHERN BLOT: The gel-resolved yeast RNA will be transferred to our Immobilon NY+ positively charged nylon membrane by capillary action. The image above shows the order of materials. We will do the transfer directly on the bench – starting with the Saran wrap (plastic wrap) but not include the “platform”. The gel and the lower Whatman (blotting) paper will be saturated with the 10X SSC transfer and provide the mobile liquid phase which carries the RNA upward where it sticks to the Immobilion membrane. Poke a hole through the membrane over each gel well – this shows where the top of the gel is and notes the position to place the florescent mirror for imaging

VERY IMPORTANT: Be sure that the paper towels do not "hang over" the gel and touch its sides or the towel/plastic wrap beneath. This would cause the system to short circuit (that is, draw the liquid from a direction other that bottom to top). Blot overnight on the bench top. After transfer, the TA will photograph the transfer with a ruler & then covalently crosslink the RNA to the membrane with UV light followed by baking at 80C.The bottom of the well will correspond to “0” on the ruler.

We will use the very abundant 3700 nt yeast 25S ribosomal RNA (rRNA), and nt 18S rRNA as internal molecular weight markers to create a standard curve to estimate the length of any yeast RNA that hybridizes to our probe. The Svedberg Unit (S) As ribosomal particles were first isolated from cell lysates by ultracentrifugation, the ribosomes and their sub-particles were named according to their sedimentation characteristics during centrifugation. The sedimentation properties of a particle depends on its molecular size and geometrical shape. The sedimentation characteristics also depend on the physical properties of the solution through which the particle is moving. The two eukaryotic ribosomal subunits are referred to as the 40S and the 60S ribosomal subunits. The protein-free yeast large/small subunit rRNAs are 25S and 18S respectively. Nucleic Acids Res. 2010, 38(4):

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). 2) Prepare the pTZ18/19u plasmids for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase. 3) Recover EcoRI/HindIII cut & SAP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this “vector” DNA and the recovered yeast “insert” DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. 4) Prepare E. coli cells competent for DNA transformation by CaCl2 treatment; cryopreserve the competent cells. Bonus: Comparing the sensitivity of EtBr and SYBR Safe for staining DNA in gels. 5) Create the recombinant DNA molecule by directional cloning via ligation of EcoRI/HindIII cut plasmid vector (pTZ18u/19u) & yeast DNA insert. 6) Isolate yeast RNA to be used for the identification of cellular RNA transcripts originating from your yeast DNA insert. Bonus: Determine the influence of DNA buffer concentration on the mobility of linear and circular forms of ds DNA 7. Transform your competent E. coli with your experimental & control ligation reactions. Select transformants on LB-ampicillin plates and score putative recombinant transformants as β galactosidase deficient with IPTG/Xgal. 8. Determine yeast mRNA yield & prep 15 µg for your northern blot 9. Resolve yeast total cellular RNA (nuclear, cytoplasmic, mitochondrial, poly A+/-) by denaturing gel electrophoresis (1% agarose, formaldehyde gel run in MOPS buffer). Transfer to positively charged nylon membrane (Millipore Immobilon NY+). 10. Count blue & white colonies & patch single isolates from your experimental (pTZ18/19u + insert) and control (pTZ18/19u only) transformations. EXTRA – Onsite radiation training TODAY 11. Extract and analyze plasmid DNA from the white & blue colony transformants

Laboratory notebook: Students are expected to accurately record and analyze every laboratory exercise in a laboratory notebook. The lab manual may be used instead of a separate lab notebook; please use blank sheets (or the back of protocol pages) to record you data. The notebook will be graded twice, once on the day of the mid-term exam and again at the end of the. In order to maximize the likelihood of getting full credit, students are encouraged to ask the instructor for feedback on notebook quality prior to submission for grading. To receive full credit for your notebook, be sure to address each of the following: Did you answer all of the questions that were in the lab protocols that required a formal response? Did you clearly indicate any changes in lab protocols? Did you label all graphs appropriately (X and Y axis with the correct units)? Did you draw the best straight line to connect the data points of your DNA or RNA standards? Did you indicate the position of your experimental data points? Did you fully label all gel or blot images with lane designations and note the positions of relevant bands (e.g., supercoiled plasmid DNA, the snRNA hybridization band)? Did you fully record all observations and include an evaluative interpretation/discussion of the experimental results? Where an experiment failed, did you present possible explanations? If you borrowed samples from another student to complete the experiment, did you state where the sample came from? In case of negative results, did you provide speculation on the specific steps that might have failed?

“Mini-prep” solutions to extract plasmid DNA from E. coli
Solution I (100 µl) 50 mM glucose, 10 mM EDTA, 25 mM Tris-HCl, pH 8.0. This resuspends the pellet in an osmotically stabilized buffered solution where EDTA helps inhibit divalent cation-dependent nucleases. The pellets must be dissolved completely. Hold the tube up to the light and roll the liquid around to determine if any “clumps” of cells are present. If need be, use a P-200 tip to disrupt the clumps – ok to vortex. Solution II (200 µl) 200 mM NaOH, 1% SDS). This high pH, strong ionic detergent lysis the cells. Mix by rapid inversion 5 times; do not vortex. Incubate at room temperature for 3 minutes. 3. Solution III. (150 µl) 3M Potassium acetate made by mixing 300 ml of 5M potassium acetate with 57.5 ml of glacial acetic acid and ml of sterile water. This high-salt solution neutralizes the pH and causes proteins and chromosomal DNA (but not plasmid) to precipitate. Mix by rapid inversion 5 times; do not vortex. Next, PCI extraction followed by ethanol precipitation. Run a portion of the recovered DNA on a gel

Group1 25S = 3700 nts 18S= 1,700 nts 5S = (~ nt)

Homework Example Outline
Organism: Saccharomyces cerevisiae Vector: YCplac33 Type: ds DNA plasmid Selectable marker gene for yeast: URA3 (ura4 in S. pombe). This marker gene encodes the enzyme orotidine 5'-phosphate decarboxylase which is required for uracil biosynthesis in yeast. Plasmid selection is done in yeast that have a mutation in the chromosomal ura3 gene and the transformants are selected on medium that lacks uracil. Other common selectable markers include Neomycin phosphotransferase II [NPT II/ G418 or Neomycin resistance; glyphosate-tolerant CP4 and GOX genes; Common screening tools include GFP, RFP, luciferase, GUS etc; Citation: Construction of ploidy series of Saccharomyces cerevisiae by the plasmid YCplac33-GHK. Hou L, Li X, Wang C, Cao X, Wang H. J Ind Microbiol Biotechnol Apr;40(3-4):393-7 Screen vs Selection? Screens allow you to distinguish the colonies you want from those you are not interested in (e.g., the blue/white screen we did with lacZ) Selections enrich for the desired genotype by killing cells that do not have a desired characteristic (e.g., we selected for ampicillin resistant transformants which carried the bla selectable marker gene – amp sensitive cells died)

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). 2) Prepare the pTZ18/19u plasmids for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase. 3) Recover EcoRI/HindIII cut & SAP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this “vector” DNA and the recovered yeast “insert” DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. 4) Prepare E. coli cells competent for DNA transformation by CaCl2 treatment; cryopreserve the competent cells. Bonus: Comparing the sensitivity of EtBr and SYBR Safe for staining DNA in gels. 5) Create the recombinant DNA molecule by directional cloning via ligation of EcoRI/HindIII cut plasmid vector (pTZ18u/19u) & yeast DNA insert. 6) Isolate yeast RNA to be used for the identification of cellular RNA transcripts originating from your yeast DNA insert. Bonus: Determine the influence of DNA buffer concentration on the mobility of linear and circular forms of ds DNA 7. Transform your competent E. coli with your experimental & control ligation reactions. Select transformants on LB-ampicillin plates and score putative recombinant transformants as β galactosidase deficient with IPTG/Xgal. 8. Determine yeast mRNA yield & prep 15 µg for your northern blot 9. Resolve yeast total cellular RNA (nuclear, cytoplasmic, mitochondrial, poly A+/-) by denaturing gel electrophoresis (1% agarose, formaldehyde gel run in MOPS buffer). Transfer to positively charged nylon membrane (Millipore Immobilon NY+). 10. Count blue & white colonies & patch single isolates from your experimental (pTZ18/19u + insert) and control (pTZ18/19u only) transformations. EXTRA – Onsite radiation training 11. Extract and analyze plasmid DNA from the white & blue colony transformants 12. Prehybridization of the northern blot of yeast cellular RNA TODAY 13. Prepare recombinant DNA for in vitro transcription (linearize plasmid downstream of insert). 14. Use Qiagen kit to prepare the uncut recombinant plasmid for DNA sequencing (this removes inhibitors of DNA polymerase that co-purify with DNA in the plasmid “miniprep” protocol 15. Short quiz

Lane 1: Blue Lane 2: Blue Lane 3: White (recomb)
Lane 5: Original uncut 19U Lane 6: 1kb ladder Good yield of DNA from both blue and white colonies. DNA looks intact (not degraded) and similar to the original non-recombinant pTZ19u I provided. The DNA from the white colonies moves more slowly since it is larger (by the size of the yeast “insert” DNA). Conclusions: 1) Successful cloning and 2) great recovery of the desired recombinant plasmid DNA

In this step you will cleave the recombinant vector just 3' (downstream) of the yeast insert DNA to prepare the DNA template for in vitro transcription. Cleave ~ 2 μg of your recovered recombinant plasmid DNA (~ 7 μl – show the gel image of your DNA to the instructor or TA to confirm the amount prior to setting up the reaction) with HindIII (those with vector plasmid pTZ18u) or with EcoRI (those with vector plasmid pTZ19u). BE SURE TO USE THE CORRECT ENZYME!!!!! Add 3 μl of the 10X CutSmart buffer (recipe in Lab 1), 18 μl (or as needed to increase the volume to 27 μl) of sterile water, mix then add 2 μl (~30 units) of the appropriate of restriction enzyme (always add enzyme last to a mixed solution). Mix briefly, spin briefly, then incubate for 45 min. at 37C (be sure that the water bath is set to the proper temperature).

Homework Question 1. Estimated length of yeast DNA (“insert” DNA): 650 bp Mass in Daltons = 650 bp X 650 Da/bp = ~422,500 Da (423 kDa) # molecules (from NEB catalog) 1 ug of 1000 bp fragment = 9.1 X 1011 molecules We have 4 ug of a 650 bp DNA fragment, so 9.1 X 1011 X 4 X 1000/650 = 5.6 X molecules or using Avogadro's number of X 1023 molecules/mole where 422,500 gm of the 650 bp fragment = 1 mole 422,500 gm/1 mole = 4 X 10-6 g/X mole = X mole 6.022 X 1023 molecules/mole = X molecules/9.467 X mole X= 5.7 X molecules # of 5’ ends is twice the number of ds DNA molecules (since each strand has one 5’ end) So, 5.7 X molecules X 2 = 1.14 X ’ ends in 4 ug of your 650 bp insert DNA

See: http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi
Question 2: What is a neoschizomer? Two different restriction endonucleases (typically isolated from different organisms) that share the same DNA recognition sequence but cut at two different positions within the sequence. Example from NEB book AatII (recognition sequence: GACGT↓C) and ZraI (recognition sequence: GAC↓GTC). A subclass of isoschizomers. What is an isoschizomer? Restriction enzymes that have the same recognition sequence and (other than neoschizomers) the same cleavage site, e.g., SphI (CGTAC/G) and BbuI (CGTAC/G) Question 3: The genetic code is NOT actually universal. Provide two different examples where a specific codon (group of 3 nucleotides) defines different genetic information than what is produced by nuclear genes that mRNA. List the codon, state what is encoded in the standard and the atypical genetic code, and state the organism and genome (e.g., nuclear, chloroplast, mitochondrial) involved. See: For an extensive list of exceptions

After your DNA digestion is complete, add 150 μl of PCI and 120 μl of TE to your digestion. Vortex intermittently over 3 min. Spin at full speed in the microfuge to separate the aqueous and organic phases and transfer the DNA-containing aqueous layer to a fresh tube (at the end of the day, discard the phenol in the waste container located in the hood). Extract the sample (the upper phase from the PCI extraction) with 50 μl of chloroform. Mix as before, spin and then transfer the supernatant to a fresh tube. Add 50 μl of 3M sodium acetate and 600 μl of 100% ethanol to your sample. Vortex, place on dry ice for 5 min. Be sure that the sample is not frozen (hold in hand to thaw if needed; then vortex briefly). Spin for 10 min. in the microfuge at full speed. Discard the ethanol and wash the pellet with 1 ml of ice cold 80% ethanol. Vortex and spin the sample for 3 min. in the microfuge (no dry ice step this time). Repeat the 80% ethanol wash, and then fully dry the pellet under vacuum. Resuspend the pellet in 10 μl of sterile water. Run the indicated amount on an agarose gel and freeze the remainder will be prepped for DNA sequencing (see below).

Web image showing similar banding patterns (look at last lane only).
Dimers and other multimers form by plasmid recombination. We also sometimes see small amounts of slowly migrating E. coli DNA in the area.

Electron micrograph of different levels of supercoiling of plasmid DNA

Progressive relaxation of supercoiled DNA by topoisomerase II activity
Progressive relaxation of supercoiled DNA by topoisomerase II activity. PNAS, 93:14416–14421 (1996) Novobiocin is an inhibitor of this type II (ATP dependent) topoisomerase. Some cancer drugs target topoisomerase – why might this be a good strategy in cancer? Topoisomerase I inhibitors: irinotecan, topotecan, camptothecin and lamellarin D all target type IB topoisomerases, Topoisomerase II inhibitors: etoposide (VP-16), teniposide, doxorubicin, daunorubicin, mitoxantrone, amsacrine, ellipticines, aurintricarboxylic acid,[5] and HU-331, a quinolone synthesized from cannabidiol.

QIAGEN CLEANUP STEP for DNA Sequencing of the Recombinant pTZ18u or pTZ10u plasmid DNA (from WHITE colony). This step isn’t required for routine DNA use but greatly improves the quality of DNA sequencing observed with miniprep DNA by removing unknown inhibitors to the DNA polymerase. Add 150 µl of high salt PB buffer (5.0 M GuHCl, 30% isopropanol) the stock tube of uncut recombinant plasmid DNA and vortex well. This is the DNA from the WHITE COLONY. Check with the TA or Dr. Rymond if there is any confusion on which DNA to use. Put a QIAquick (Qiagen) spin column (containing a silica-based gel resin) in a 2 ml collection tube. Add all of your DNA to the column, incubate for 1 minute at room temperature then spin for 1 minute in a microfuge at full speed. DISCARD the flow-through. Add 150 µl of PB to the column, spin 1 minute as before. Discard the flow-through. Add 0.75 ml of PE wash buffer (80% ethanol in 10 mM Tris, pH 7.5), allow to sit at room temperature for 1 minute then spin for 1 minute as before, and discard the flow through. Spin again for an additional 1 minute to remove all residual PE liquid.

Place the column in a new clean 1.5 ml microfuge tube.
Add 50 μl of elution buffer (EB 10 mM Tris, pH 8.5) pre-warmed to 55C to your column (directly over sample), INCUBATE at room temperature for 1 minute. All suggested in the Qiagen protocol, substitution of water for EB is NOT recommended as the pH difference can lower recovery. Spin 1 minute. Your DNA is now ready for DNA sequencing. Label your tube with your group number plus either “Recomb.18” or “Recomb. 19” – bring it to the front of the room and place on dry ice

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). 2) Prepare the pTZ18/19u plasmids for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase. 3) Recover EcoRI/HindIII cut & SAP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this “vector” DNA and the recovered yeast “insert” DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. 4) Prepare E. coli cells competent for DNA transformation by CaCl2 treatment; cryopreserve the competent cells. Bonus: Comparing the sensitivity of EtBr and SYBR Safe for staining DNA in gels. 5) Create the recombinant DNA molecule by directional cloning via ligation of EcoRI/HindIII cut plasmid vector (pTZ18u/19u) & yeast DNA insert. 6) Isolate yeast RNA to be used for the identification of cellular RNA transcripts originating from your yeast DNA insert. Bonus: Determine the influence of DNA buffer concentration on the mobility of linear and circular forms of ds DNA 7. Transform your competent E. coli with your experimental & control ligation reactions. Select transformants on LB-ampicillin plates and score putative recombinant transformants as β galactosidase deficient with IPTG/Xgal. 8. Determine yeast mRNA yield & prep 15 µg for your northern blot 9. Resolve yeast total cellular RNA (nuclear, cytoplasmic, mitochondrial, poly A+/-) by denaturing gel electrophoresis (1% agarose, formaldehyde gel run in MOPS buffer). Transfer to positively charged nylon membrane (Millipore Immobilon NY+). 10. Count blue & white colonies & patch single isolates from your experimental (pTZ18/19u + insert) and control (pTZ18/19u only) transformations. EXTRA – Onsite radiation training 11. Extract and analyze plasmid DNA from the white & blue colony transformants 12. Prepare recombinant DNA for in vitro transcription (linearize plasmid downstream of insert); Qiagen prep DNA for sequening. TODAY 14. Prehybridization of the northern blot of yeast cellular RNA 15. Check recombinant plasmid recovery from Qiagen column Review Quiz

Oct 11: Exam 1 & Notebooks due
Participation Sheets (must be turned in the same day as the question asked/answer provided) Name (please print): ________________________________________________ Date of question/answer_______________________________________________ Counted twice a semester, once at mid-term and once at the end of the semester. You have until October 8th to contribute five question or answers I will accept a Q&A form today for anyone who asked Assoc. Director Radiation Safety David Rich a question on Friday

Please remember, the lab day isn’t through until you:
Appropriately store all your DNA or culture samples Discard phenol waste in the hazardous waste discard bottle in the hood Discard waste plate yeast/bacteria/C. elegans plate cultures in the orange biohazard bag (waste liquid cultures in a waste container near sink) Discard all non-hazardous materials (tubes, pipets, etc) in the trash or sink. This includes discarding the contents of your discard containers on your bench Wipe down your bench with bleach solution Ask Christen for assistance if you have a question whether something should be saved or discarded

Resolve your Qiagen DNA on a mini-gel (rather than the “large gel” indicated).
Lane Sample DNA (µl) Dye ((µl) 1 kbp DNA ladder Qiagen –student Qiagen – student After staining, students will take their our gel images today. Remember to print two copies of the image (one for each student in the group)

VERY IMPORTANT: Be sure that the paper towels do not "hang over" the gel and touch its sides or the towel/plastic wrap beneath. This would cause the system to short circuit (that is, draw the liquid from a direction other that bottom to top). Blot overnight on the bench top. After transfer, the TA will photograph the transfer with a ruler & then covalently crosslink the RNA to the membrane with UV light followed by baking at 80C.The bottom of the well will correspond to “0” on the ruler.

Group1 25S = 3700 nts 18S= 1,700 nts 5S = (~ nt)

Northern blot prehybridization
At this time, a print of your cellular RNAs are covalently bound to the surface of the positively charged nylon membrane. The next step is to block all remaining free surface (i.e., not bound with your RNA) on the nylon membrane with a non-specific nucleic acid. Why do we do this? The blocking step is done with heat denatured salmon sperm DNA in a solution composed of simple salts (6X SSC) and detergents and organic compounds that promote nucleic acid/membrane interactions (Denhardts). Why do you think salmon sperm DNA is used? We will wrap the membrane in synthetic nylon mesh and place this in a glass roller bottle which will rotate to distribute the blocking solution over the northern blot surface. Be sure that the roller bottle is tightly capped.

Northern Blot Prehybridization (Each Group)
Northern Blot Prehybridization (Each Group). The positively charged nylon membrane has a very high affinity for single-stranded nucleic acids. If your labeled hybridization probe was directly presented to this membrane it would irreversible stick to the membrane surface. The prehybridization step “blocks” the exposed portions of the membrane filter with a non-specific nucleic acid. Thus, when your labeled hybridization probe is added it will associate by base pairing with your size fractionated RNA and not directly adhere to the membrane surface. Heat 2.5 mg (0.25 ml of 10 mg/ml) of salmon sperm DNA at 100oC for 10 min. Rapidly transfer the denatured DNA to ice for 5 min. While the DNA is denaturing, label the bottom left hand corner of your blot with your initials. The RNA transferred to the blots was covalently locked on the membrane with UV light using a Stratagene Stratalinker (measure dose of 120,000 micro joules at 254 nm –see pdf on the class web site) and the membrane baked in a vacuum oven at 80C for 2 hours. Photographs were taken by the TA prior to baking Wet your blots by soaking for 5 minutes in ~50 ml of 6X SSC.

Roll your blot in a mesh strip and place both inside a glass roller bottle. NOTE: Be sure to remove all air bubbles from between the mesh and the membrane – simply roll a freshly gloved finger over the membrane to squeeze out the air bubbles. Holding the glass bottle in your right hand with the open end pointing to your left, the mesh should be inserted such that the fold is going over the top of the roll. Add 10 ml 6X SSC and roll at room temperature for 5 minutes (this will spread out the mesh in the tube if you inserted the roll correctly; the mesh will remain in a tight roll if inserted incorrectly). Add your denatured salmon sperm DNA to 10 ml of prehybridization solution composed of: 6X SSC, 5X Denhardts solution (0.1g Ficoll, 0.1g polyvinylpyrrolidone, 0.1g bovine serum albumin per 100 ml), 50mM sodium phosphate, 1% SDS. Mix by shaking the plastic Falcon tube. Pour out the 6X SSC from the roller bottle and replace with the 10 ml prehybridization plus salmon sperm DNA. Tightly cap the roller bottle and incubate with rolling at 60oC for 24 hours. Tomorrow, the TA will place the roller bottles into the refrigerator until needed. For most research labs, the refrigeration step is not needed since the membranes are used directly after the prehybridization step.

Ficoll is a highly branched sucrose polymer.
Polyvinylpyrrolidone is a second synthetic polymer – both added as stabilizing agents that inhibit background binding of probe to the membrane and promote nucleic acid hybridization. NOTE: The next lab uses radioactivity, be sure to bring your lab coat and also read the in Riboprobe vitro transcription manual (on the web site). A second good overview of in vitro transcription is presented in the Life Technologies web site (open the “manual” link on this web page:

1. Circle the best correct response in parentheses. During gel electrophoresis, self-ionization of water occurs (at the anode, at the cathode, throughout the running buffer) to form (electrons, neutrons, hydrogen and hydroxide ions). Ion oxidation occurs at (the anode only, the cathode only, the anode and the cathode). (1.5 pts) Describe step-by-step (and in mechanistic terms) what role ATP plays in the DNA joining reaction by T4 DNA ligase. (2 pts) ATP hydrolyzed to AMP and ppi with AMP covalently joined to the T4 DNA ligase at an internal lysine residue. The AMP-ligase transfers AMP to the 5’ end of the dsDNA target. Ligase uses the ADP formed on the DNA as a high energy bond to promote phosphodiester bond formation via the juxtaposed 3’ hydroxyl of the DNA target.

3. The XpaI enzyme leaves (5’ extensions
3. The XpaI enzyme leaves (5’ extensions. 3’ extensions, blunt ends) that can be ligated to DNA that is cut by (Pss1, Str3, Trx2, all of these enzymes, none of these enzymes). Normal nomenclature is used (5’-3’ left to right on the “top” strands; slash (/) is the cutting site (2 pts) XpaI C/TTAAC Str3 G/AATTG Trx2 ATTAA/C GTATT/G CTTAA/C T/AATTG Pss1 CTT/AAC GAA/TTG 4. This compound is (likely to bind DNA by intercalation; bind DNA by ionic interaction; precipitate DNA when present in aqueous solutions; not bind DNA). (1 pt) 5. In her E. coli transformation experiment BIO 510 student Mary finds 12 white and 737 blue ampicillin resistant colonies while Ben finds 15 white and 38 blue ampicillin resistant colonies. The same amount of vector DNA was used in each transformation. Which student had a better transformation efficiency? Provide the logic that supports your answer ( 1pt). Mary – all ampicillin resistant colonies are transformants, it does not matter what color these are.

Size exclusion chromatography; gel filtration

We will use molecular exclusion chromatography on Wednesday to separate the P-32 labeled RNA we synthesize (the large molecules) from the unincorporated 32-UTP precursor (small molecules) The chromatography resin we will use is G-25 sepharose (agarose) beads made by the IBI corporation. G-25 refers to the size of the excluded molecules in kDa. Molecules >25,000 Da (25 kDa) do not enter the beads and are therefore found in the rapidly eluted EXCLUDED volume. Molecules less that 25,000 Da enter the beads and are retained in the slowly released INCLUDED volume. What is the molecular weight of our 650 nt long RNA probe? 650 bases X 325 (mass/base) = 211,250 Da (or kDa) Excluded or Included? Is it > or < 25 kDa? What is the molecular weight of the 32-P UTP? C9H15N2O15P3 = 484 Da (or kDa) Excluded or Included? Is it > or < 25 kDa?

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). 2) Prepare the pTZ18/19u plasmids for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase. 3) Recover EcoRI/HindIII cut & SAP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this “vector” DNA and the recovered yeast “insert” DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. 4) Prepare E. coli cells competent for DNA transformation by CaCl2 treatment; cryopreserve the competent cells. Bonus: Comparing the sensitivity of EtBr and SYBR Safe for staining DNA in gels. 5) Create the recombinant DNA molecule by directional cloning via ligation of EcoRI/HindIII cut plasmid vector (pTZ18u/19u) & yeast DNA insert. 6) Isolate yeast RNA to be used for the identification of cellular RNA transcripts originating from your yeast DNA insert. Bonus: Determine the influence of DNA buffer concentration on the mobility of linear and circular forms of ds DNA 7. Transform your competent E. coli with your experimental & control ligation reactions. Select transformants on LB-ampicillin plates and score putative recombinant transformants as β galactosidase deficient with IPTG/Xgal. 8. Determine yeast mRNA yield & prep 15 µg for your northern blot 9. Resolve yeast total cellular RNA (nuclear, cytoplasmic, mitochondrial, poly A+/-) by denaturing gel electrophoresis (1% agarose, formaldehyde gel run in MOPS buffer). Transfer to positively charged nylon membrane (Millipore Immobilon NY+). 10. Count blue & white colonies & patch single isolates from your experimental (pTZ18/19u + insert) and control (pTZ18/19u only) transformations. EXTRA – Onsite radiation training 11. Extract and analyze plasmid DNA from the white & blue colony transformants 12. Prehybridization of the northern blot of yeast cellular RNA 13. Prepare recombinant DNA for in vitro transcription (linearize plasmid downstream of insert). Store pre-hybridized membrane until use next Monday. TODAY 14. In vitro transcription of 32P-labeled plus (+) and minus (-) strand DNA probes with T7 RNA polymerase 15. Separation of unincorporated 32P-UTP from the probe by size exclusion chromatography

The protein was from the human SMN gene which is found duplicated on chromosome 5 (SMN1 & SMN2). The best known function for the SMN protein is as an assembly factor for the hetero-heptameric Sm protein complex found on the 3’ ends of the spliceosomal small nuclear RNAs (snRNAs). Loss of SMN function results in the disease Spinal Muscular Atrophy, the #1 genetic cause of infant mortality. Human X Mouse SMN comparison Human X Zebrafish SMN comparison

In Vitro Transcription Reaction:
Pipet 3.0 µl of cut recombinant DNA (recombinant 18u or 19uwith yeast DNA insert cut with EcoRI or HindIII) into 7 µl of the reaction mix containing: 1 µl of the NEB 10X buffer Nucleotides to a final 1X concentration of: 1 mM ATP,CTP,GTP; 4µM UTP 2.5 µl 32-P UTP 1 µl of T7 RNA polymerase Sterile water to 7 µl First thing to do – show me the most recent gel photo of your EcoRI (or HindIII) cut recombinant plasmid prepared in Lab 7 (last Wednesday). Depending on the cutting efficiency or yield, I may have you use: a) more or less than 3 µl of DNA for today’s in vitro transcription b) use another group’s (or my) DNA for today’s transcription

NEB 10X Transcription Reaction Buffer
400 mM Tris-HCl 60 mM MgCl2 10 mM DTT (dithiothreitol; reducing agent that prevents inappropriate disulfide bond formation) 20 mM spermidine pH Spermidine is a polycationic organic compound (C7H19N3) where a positive charge on the amino groups helps promote protein (here, T7 RNA polymerase) interaction with negatively charged DNA or RNA.

Pipet 3.0 µl of cut recombinant DNA (recombinant 18u or 19uwith yeast DNA insert cut with EcoRI or HindIII) into 7 µl of the reaction mix containing: 1 µl of the NEB 10X buffer * Nucleotides to a final 1X concentration of: 1 mM ATP,CTP,GTP; 4µM UTP 2.5 µl 32-P 800 Ci/mmol (adds ~ 1µM of additional UTP) 1 µl of T7 RNA polymerase Sterile water to 7 µl Label the tube with your initials & 32-P. Cap the tube well and mix very briefly (1 second) on the vortex. Spin very briefly (3 seconds) and then incubate at 37oC for 45 min. [NOTE: Save the remainder of your cut plasmid DNA in the freezer ‑ we will use it again later.] I will call groups to the radiation area. Be sure to: a) wear two-pairs of gloves & discard the upper layer before you leave b) bring ONLY your cut recombinant DNA c) label your tube with your initials – the cap already says 32-P and 18u or 19u d) transfer 3µl of your cut DNA into the tube containing radioactivity e) vortex briefly (1 second), spin briefly (3 seconds), place at 37C f) remove outer set of gloves get checked for radioactive contamination with the survey meter before leaving back bench area

Radioactive RNA hybridization probe (“riboprobe”) synthesis
2. After the 45 min. incubation, spin again briefly and then carefully open the tube with a plastic tube opener. Add 1 µl (1 unit) of DNase I to the reaction and cap the tube well. Vortex briefly, spin briefly, and then incubate for 5 min at 37oC. Why do we add DNase I? 3. After the 5 min. incubation, spin again briefly and then carefully open the tube with a plastic tube opener. Add 120 µl of TE to the probe solution.

Radioactive RNA hybridization probe (“riboprobe”) cleanup & quantification
4. Separate the unincorporated nucleotides by pipetting the 130 µl of probe (NOTE: to avoid contamination of your Pipetman, pipette ~70 µl twice and move the Pipetman plunger very slowly) into the pre‑packed Bio-Spin 6 column (BioRad; see “documents” at: also on our class web site) with a collection tune inserted into a glass plastic test tube. Spin for 2 min at full speed in the microfuge. 6. The solution that flows into the collection tube contains your RNA probe; the column retains the unincorporated nucleotides. DISCARD THE column SAVE THE flow through liquid. 7. Place 1 µl of your probe into a scintillation vial, determine the cpm (counts per minute) of the sample. Label the CAP of the scintillation vial with your GROUP number, your initials and either 18u or 19u (depending on which recombinant probe you made today).

Scintillation counter – beta particle emissions from the 32-P radioactive decay are absorbed by an organic scintillation cocktail which emits a secondary light photon identified by the photomultiplier tube and converted into electrical signals presented as counts per minute (CPM). Decays (or disintegrations) per minute (DPM) is the unit of actual decay and differs from the CPM by the counting efficiency. How well the machine “sees/records/senses” the radioactivity depends on the particular isotope and on the efficiency of the machine used.

Assume a 90% counting efficiency (e. g
Assume a 90% counting efficiency (e.g., 90 cpm = 100 dpm (decays per min.)) and that 100 ng of RNA is synthesized during in vitro transcription (that is 0.1 µg of RNA in your 200 µl of stopped reaction), determine the specific activity (in dpm/µg) of your probe. Determine the volume of probe needed for 5 million dpm. This will be added to your blots with fresh salmon sperm DNA and fresh hybridization buffer on Monday.

Genotype (genetic background) of the host E. coli strain, TG1
TG1 (same as JM101 lacking EcoK modification/restriction system): McrA+, McrBC-, EcoKR‑, EcoKM- (hsd_5) supE, thi,(Δlac‑proAB); F'(traD36, proAB+, lacIq, lacZ_M15). * McrA, McrBC – two related endonucleases that cut foreign methylated DNA (C*pG) * hsd _5 R&S = mutations in the restriction/modification for EcoK system (methylation protects) * supE = tRNA amber suppressor (UAG), rather than stop codon, inserts glutamine, required for some phage vectors * thi = mutation that makes the cells thiamine requiring (blocks thiamine biosynthesis) * F’traD36 = mutation that reduces self‑transmissibility of F factor. * proAB‑ proline biosynthesis mutations; makes cells proline requiring * lacIq ‑ lac super-repressor (promoter mutation that increases transcription of lac repressor), inhibits expression of lac operon genes present in multi-copy vectors * (lacZ)M15 expresses a deletion of codons of the 1024 codon lacZ gene that can be complemented by the lac Z N-terminal alpha fragment (aa 3-90) fragment present in many plasmid vectors, including pTZ18u/19u.

Tra needed for DNA transfer functions
Conjugation – sometimes call the sexual cycle of bacteria; integration of plasmid into the bacterial chromosome followed by the directional transfer of DNA from the F+ donor cell type to the F- recipient cell; example, the F episome of E. coli). The pilus is also the attachment site for the M13 virus (M13K07) we will use to stimulate single-stranded DNA synthesis from pTZ18u. Tra needed for DNA transfer functions

Transcriptional inducer of the lac operon
pTZ18u, pTZ19u– made for high copy DNA amplification, RNA transcription, ds DNA AND ssDNA production. Transcriptional inducer of the lac operon IPTG X-gal Chromogenic substrate of β galactosidase

Next week we will clone a gene by complementation of genetic defect (the prp38-1 mutation) found in the yeast host strain. This will be done by transformation using plasmids containing (or lacking) the corresponding wildtype allele of this gene (i.e., PRP38). Below is an image of pTZ18u. What additional genetic features are needed to be added to pTZ18u to allow its use as a Saccharomyces cerevisiae transformation vector? A selectable marker gene that allows yeast transformants to grow & form colonies while untransformed yeast cannot. A replication origin that permits the host DNA polymerase to copy (replicate) the plasmid so that newly divided cells each receive a copy.

Ori – E. coli origin for DNA replication
YCplac33: E. coli Saccharomyces cerevisiae shuttle vector Type: ds DNA plasmid. Selectable marker gene for yeast: URA3. This marker gene encodes the enzyme orotidine 5'-phosphate decarboxylase which is required for uracil biosynthesis in yeast. Plasmid selection is done in yeast that have a mutation in the chromosomal ura3 gene and the transformants are selected on medium that lacks uracil. Ori – E. coli origin for DNA replication AmpR ampicillin resistance gene (bla) for E. coli selection – does not work for yeast CEN/ARS – Two distict DNA sequences, one a yeast chromosomal centromere (mitotic and meiotic stability) and the second a DNA replication origin (Autonomous Replication Site)

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u. 1) Gel fractionate the EcoRI/HindIII cleaved yeast DNA and recover the yeast DNA band free of a second DNA band (originating from another plasmid, pUC19 which lacks some of the desired features of pTZ18u & pTZ19u). 2) Prepare the pTZ18/19u plasmids for directional DNA cloning but cutting each plasmid at its multiple cloning site with two different restriction endonucleases, EcoRI and HindIII. To ensure that the any singly-cleaved plasmid DNAs do not “self ligate” (which will increase the background of non-recombinant clones subsequently recovered) we will remove the 5’ phosphate from the vector DNA with shrimp alkaline phosphatase. 3) Recover EcoRI/HindIII cut & SAP-treated pTZ18u (or 19u) DNA by ethanol precipitation & centrifugation. Score yield and integrity of this “vector” DNA and the recovered yeast “insert” DNA by agarose gel electrophoresis. Also, score the differences in DNA migration of the linear, circular and supercoiled forms of your plasmid DNA. 4) Prepare E. coli cells competent for DNA transformation by CaCl2 treatment; cryopreserve the competent cells. Bonus: Comparing the sensitivity of EtBr and SYBR Safe for staining DNA in gels. 5) Create the recombinant DNA molecule by directional cloning via ligation of EcoRI/HindIII cut plasmid vector (pTZ18u/19u) & yeast DNA insert. 6) Isolate yeast RNA to be used for the identification of cellular RNA transcripts originating from your yeast DNA insert. Bonus: Determine the influence of DNA buffer concentration on the mobility of linear and circular forms of ds DNA 7. Transform your competent E. coli with your experimental & control ligation reactions. Select transformants on LB-ampicillin plates and score putative recombinant transformants as β galactosidase deficient with IPTG/Xgal. 8. Determine yeast mRNA yield & prep 15 µg for your northern blot 9. Resolve yeast total cellular RNA (nuclear, cytoplasmic, mitochondrial, poly A+/-) by denaturing gel electrophoresis (1% agarose, formaldehyde gel run in MOPS buffer). Transfer to positively charged nylon membrane (Millipore Immobilon NY+). 10. Count blue & white colonies & patch single isolates from your experimental (pTZ18/19u + insert) and control (pTZ18/19u only) transformations. EXTRA – Onsite radiation training 11. Extract and analyze plasmid DNA from the white & blue colony transformants 12. Prehybridization of the northern blot of yeast cellular RNA 13. Prepare recombinant DNA for in vitro transcription (linearize plasmid downstream of insert). Store pre-hybridized membrane until use next Monday. 14. In vitro transcription of 32P-labeled plus (+) and minus (-) strand DNA probes with T7 RNA polymerase 15. Separation of unincorporated 32P-UTP from the probe by size exclusion chromatography TODAY 16. Hybridization of each groups blot with radiolabled RNA (riboprobe) transcribed from the yeast DNA insert of the recombinant pTZ18u and pTZ19u plasmids NEW EXPERIMENT ********************* Part I - Cloning a gene by genetic complementation

PREPARING FOR EXAM I – Posted in Canvas
For lab – review the lab manual and associated readings referred to in the lab manual & those handed out in the lab. Review last year’s exam. Ask yourself – what did I do, how did I do it, what did I observe, how can I explain the observations? You will not be asked to details such as the concentration of reagents used in a reaction, but you should know the purpose of reagents (e.g., what is a buffer & why is it used?) What is BSA and why is it in restriction digestions? What is the enzymatic activity encoded by the bla gene of E. coli?). Experiment 1. Cloning and characterization of a eukaryotic gene. Goal – to test the hypothesis that a segment of Saccharomyces cerevisiae DNA encodes a yeast gene. Clone a segment of yeast DNA Gel fractionate and purify a piece of yeast DNA (“insert DNA”) Cut pTZ18u/19u cloning vectors with EcoRI and HindIII Prepare competent TG1 E. coli Ligate PTZ vector with insert DNA and transform into the competent E. coli Select transformants on ampicillin plates and score for insertional inactivation of the lacZ gene using X-gal/IPTG for blue/white screen Isolate DNA from the presumed recombinant and non-recombinant transformants and determine whether your cloning experiment was successful (i.e., that you generated the desired vector plus insert construct) Determine whether the cloned yeast DNA contains a gene naturally expressed in yeast Isolate total RNA from yeast. Quantify and fractionate this RNA by denaturing gel electrophoresis Transfer the gel-fractionated RNA to a charged nylon membrane and pre-hybridize the membrane. Prepare + and – strand “riboprobes” by in vitro transcription of your recombinant DNA with T7 RNA polymerase and NTPs (including 32-P UTP). Quantify radiolabel incorporation and add probe to membrane transfer of yeast RNA in the hybridization step Wash off excess probe and expose the membrane to a phosphorimager screen. Use the Typhoon phosphoimager to detect the radioactivity signatures stored on the phosphoimager screen. Based on the signals obtained with the two hybridization probes determine whether the cloned DNA segment contains at gene and if so, determine the direction of transcription in yeast of the natural transcript with respect to the EcoRI and HindIII restriction sites (assume that these same sites are present in the genome of yeast at this locus). Use of phosphoimager Identify the specific gene encoded by your “insert DNA” Purify the double stranded DNA on a Qiagen column and direct it to the sequencing center ….

Gene identification by in vivo complementation: yeast transformation (each group does a set of three transformants). A critical test of whether a cloned DNA encodes a gene of interest is to determine whether that DNA genetically complements a strain deficient in the activity under study. Today, we will transform a conditional‑lethal strain of yeast, prp38-1, which contains a single base pair mutation in the PRP38 gene which results in an aspartic acid (D) for glycine (G) substitution at codon 66. This change makes the protein temperature sensitive (ts) – functional at room temperature but with much reduced activity at 37C. Consequently, while wildtype (PRP38) yeast grows well at 37C, the prp38-1 mutants are severely growth impaired a 37C. MAVNEFQVES NISPKQLNNQ SVSLVIPRLT RDKIHNSMYY KVNLSNESLR GNTMVELLKV 61 MIGAFG(D)TIKG QNGHLHMMVL GGIEFKCILM KLIEIRPNFQ QLNFLLNVKN ENGFDSKYII 121 ALLLVYARLQ YYYLNGNNKN DDDENDLIKL FKVQLYKYSQ HYFKLKSFPL QVDCFAHSYN 181 EELCIIHIDE LVDWLATQDH IWGIPLGKCQ WNKIYNSDEE SSSSESESNG DSEDDNDTSS 241 ES*

Yeast host strain: ts192 Genotype: Matα trp1-289 ura3-52 his 3 leu2-3, 112 prp38-1 Yeast transformation vector: YCplac33 (URA3) empty vector Or YCplac33-PRP38 (URA3) recombinant vector with a portion of the yeast genome containing the PRP38 gene pTZ18u (no selectable marker or replication sequences for yeast) The plasmids are coded (A, B and C), your job is to determine “which code letter is each genotype” based on the phenotypic characterization of your transformants.

Ori – E. coli origin for DNA replication
YCplac33: E. coli Saccharomyces cerevisiae shuttle vector Type: ds DNA plasmid. Selectable marker gene for yeast: URA3. This marker gene encodes the enzyme orotidine 5'-phosphate decarboxylase which is required for uracil biosynthesis in yeast. Plasmid selection is done in yeast that have a mutation in the chromosomal ura3 gene and the transformants are selected on medium that lacks uracil. Ori – E. coli origin for DNA replication AmpR ampicillin resistance gene (bla) for E. coli selection – does not work for yeast CEN/ARS – yeast chromosomal centromere (mitotic and meiotic stability) and DNA replication origin (Autonomous Replication Site)

URA3 Multiple enzymes needed to produce UTP from glutamine. URA3 is one of seven genes in this UTP biosynthesis pathway. Mutations in any of these genes leave the cell unable to grow in the absence of uracil (which is made via removal of phosphate and ribose from UMP). NOTE: the Ura3 enzyme does NOT make uracil, it makes uridine monophosphate

Today we will transform the prp38-1 mutant yeast with 3 different plasmids,
one of which is the YCplac33 vector containing a fully functional (i.e., wildtype) copy of PRP38 which can complement the prp38-1 growth defect and restore efficient growth at 37C. one of which is an empty vector (i.e., YCplac33 plasmid without the PRP38 gene) One of which is pTZ18u Our job is to determine which of the three plasmids contains PRP38. Note, while we are working with only three plasmids, often this “complementation” experiment is conducted with a mixture of thousands of different plasmids (that is a recombinant DNA library) containing overlapping portions of the yeast genome – with the goal of “cloning a gene” by complementation of an uncharacterized mutation. A paper on the cloning of PRP38 via yeast complementation is required reading on Canvas and will be discussed at the end of the semester.

What do you predict? Colonies on -ura 23C Colonies on -ura 37C Coded DNA: A, B or C Ts192(not transformed) Ts192 + YCplac33 empty vector Ts192 + recombinant YCplac33 (PRP38) pTZ18u

Each Group 510 protocol; Rapid Yeast Transformation (see PGMG 202-206)
Each Group Transforms all Three Plasmids (A, B and C) Start off with ~50 ml of a mid to late log culture of prp38-1 yeast (OD 600 between 2 and 4) grown in YPD medium. Spin out yeast 5,000 rpm for 5 minutes. Rapidly pour off the growth medium. 2. Wash the culture twice with 5 ml of Li buffer (100 mM LiOAc, 10 mM Tris pH 7.5, 1 mM EDTA). Spin 5 minutes at 5,000 rpm between each wash. NOTE: Use the plastic 5 (or 10) ml pipet and the green pipet filler to transfer the Li buffer not the P-1000 pipetman. 3.After the second 5 ml wash, resuspend the yeast cell pellet in 2 ml of Li buffer.

Each Student (each group uses all three plasmids, coded A, B and C)
4. Add 500 µl of culture to each 13X100 mm (small) capped glass culture tube. Prepare and label one tube for each DNA to be tested. Be sure to note the specific construct used. 5. Add plasmid DNA (1-3 µg in 10µl), incubate for 5 minutes at room temperature. 6. Add 25 µl of 10 mg/ml salmon sperm DNA (heat denatured for 10 then quick chilled on ice prior to use). NOTE: Get the denaturation started during the yeast wash steps (#2, above), since it takes some time to complete. 7. Add 25 µl of DMSO incubate 10 minutes at room temperature. 8. Add 2.5 ml of 40% PEG 3000 in Li buffer. Incubate for 30 minutes at 30C. 9. Heat shock at 42C for 15 minutes. 10. Spin out the culture, wash once in 1 ml of sterile (i.e., freshly autoclaved) water. You can vortex to mix the cells. Spin the cells for 5 minutes at full speed in the clinical (tabletop) centrifuge. Pour off the liquid. Vortex what is left in the tube (usually ~ 150 µl of liquid remains) and plate the yeast evenly on two selective plates (estimate volumes). You can expect transformants per microgram of plasmid DNA. Incubate one plate at 23C and one plate at 37C. IMPORTANT NOTES: 1. Use sterile technique throughout the experiment but do not hold the pipettes over a flame or you will kill the cells. 2. Check to be sure that the water bath is at the right temperature before starting the experiment. 3. Use the clinical centrifuge for all spins. A 5 minute spin at room temperature should be sufficient to pellet the yeast. However, if not all cells pellet and the solution is still cloudy, spin again. 4. Be sure that you use water that was recently autoclaved/sterilized for your washes. Be careful not to disturb the pellet when removing the wash solution.

Northern Blot Hybridization (Each Group)
Now you will incubate the radioactive synthetic ssRNA probe (i.e., your “riboprobe”) with your transfer membrane in a solution that will foster hybridization with the yeast cellular RNA crosslinked to the membrane surface. We discard the prehybridization solution in case any yeast RNA was shed from the membrane during the incubation - such released RNA will compete with the filter bound RNA for hybridization to your probe. In most protocols (including this one), the prehybridization and hybridization solutions differ only in the whether or not the labeled probe is present. 1. Open your prehybridization roller bottle and remove the membrane. Place the membrane on a clean piece of plastic wrap. Rapidly cut your membrane (BUT NOT THE MESH) in ½ using the notches on the top and bottom as guides. Be sure to wear gloves and do not place the blot down on any surface other than on the plastic wrap. 2. Wrap one half of your membrane and one half of the membrane from another student in mesh. Obtain a membrane from a student that is using the other recombinant clone (if you are using pTZ18u, exchange with a group that is using pTZ19u and vice versa) and give this group your other membrane half. Be sure to label the bottom of your membrane with your initials. Add 10 ml of hybridization solution ‑ salmon sperm DNA was already added to this by the T.A. 3. Group 1 exchange one half of your membrane with group 4 (and gp 4 exchange half of their membrane with gp 1); group 2 exchange half of your membrane with group 3 (and gp 3 exchange half of their membrane with gp 2)

BIO P incorporation in to the +/- strand riboprobes using T7 RNA polymerase. We counted 1 µl of approximately 130 µl of recovered RNA. The theoretic maximum is the # of cpm expected if 100% of the UTP was incorporated. The control reaction had no DNA or 32-P UTP added –measures environmental background. Incorporation for CB = (713, )/(770,000 – 155) X 100 = 92.5%

3. Each student will place approximately 2
3. Each student will place approximately 2.5 million cpm of probe into the fresh hybridization solution (to simplify the calculation, we will use cpm rather than dpm). There will be 4 bottles – each bottle will get either the recombinant 18u riboprobe of the recombinant 19u riboprobe. Now - Determine the volume needed for 2,500,000 cpm Say, 234,000 per microliter – then 2,500,000/234,000 = 10.7 microliters Group 1, members 1 & 2 – recom. 18 probe each in hybridization solution with denatured salmon sperm DNA, then pour into the hybridization bottle - > 60C Group 2, members 1 & 2 – recom. 18 probe each in hybridization solution with denatured salmon sperm DNA, then pour into the hybridization bottle - > 60C Group 3, members 1 & 2 – recom. 19 probe each in hybridization solution with denatured salmon sperm DNA, then pour into the hybridization bottle - > 60C Group 4, members 1 & 2 – recom. 19 probe each in hybridization solution with denatured salmon sperm DNA, then pour into the hybridization bottle - > 60C 4. Incubate with rolling at 60oC until the next lab period

Introducing today’s labs will be….
Drum roll, please Drum, drum, drum…..

Genotype (genetic background) of the host E. coli strain, TG1
TG1 (same as JM101 lacking EcoK modification/restriction system): McrA+, McrBC-, EcoKR‑, EcoKM- (hsd_5) supE, thi,(Δlac‑proAB); F'(traD36, proAB+, lacIq, lacZ_M15). * (lacZ)M15 expresses a deletion of codons of the 1024 codon lacZ gene. The encoded peptide lacks enzymatic activity but can be complemented by the lac Z N-terminal alpha fragment (aa 3-90) fragment expressed from many plasmid vectors, including pTZ18u/19u.

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u, prepare +/- riboprobes and use to detect yeast cellular on a membrane transfer of RNA resolved on a denaturing agarose gel. Wash & expose blots to detect radiation on membrane Experiment #2: Cloning a gene by genetic complementation. Goal: identify the wildtype allele of PRP38 based on complementation of the temperature sensitive prp38-1 mutation. Transform the prp38-1 mutant, ts192, with coded plasmids A, B, C – select on –ura glucose at 23C or 38C. Determine which encodes pTZ18u, YCplac33 and YCplac33-PRP38 Score plates for growth. EXPERIMENT #3: Detection of genetic differences using the polymerase chain reaction (PCR) (note, one of several PCR-based experiments used to detect genetic mutations, introduce new DNA mutations, quantify nucleic acid amount in an experimental unknown, detect novel RNA processing events) Isolate total nucleic acid from haploid wildtype yeast (SERF), from haploid yeast bearing a gene disruption (sqs1::KAN) and from diploid yeast with one of each allele (SERF/serf::KAN) Quiz #3

“Washing” the northern blot removes 32-P labeled (synthetic) probe that is NOT associated by extensive base-pairing with the yeast RNA originally transferred by capillary action from the gel to the positively changed nylon membrane. Non-specific interactions by our probe include simple wetting the membrane surface and limited base-pairing (e.g., runs of 6 or 8 base pairs) between the probe and the yeast RNA or the salmon sperm DNA used for blocking. Non-specific interactions contribute to background bands or general surface contamination (dark spots or streaks) during imaging. The stringency of hybridization or washing determines the level of background. Stringency is increased by 1) increased temperature, 2) lower salt concentrations, or 3) the addition of compounds that lower RNA-RNA melting temperature (e.g., formamide).

Washing Northern Blots (each group)
1. Carefully pour the waste probe in the large waste beaker. Rinse the roller bottle with 1/2 volume of 0.2X SSC, 0.1% SDS (recall that your hybridization conditions contained 6X SSC). Simply add the wash, cap the bottle, invert the bottle 5 times, the pour out the wash into the large waste container. 2. Wash the filters 3 X 15 min. at 60oC. Students within each group should alternate in completing the washes. The TA will pre-warm the wash solution to 50-60C before you use it. Fill the roller bottle 3/4ths full with wash solution for each wash. Be careful not to spill the radioactive wash solutions. Remove the membrane and blot off the excess liquid with a Kim wipe. Place the membrane between two pieces of plastic wrap. The TA will assist you in exposing the membranes to the Phosphoimager screen (see handout). Expose your 18u and 19u hybridizations side by side. Recall, one of the in vitro synthesized riboprobes will be complementary to the cellular RNA (and therefore hybridize) while the other will be equivalent to the cellular RNA (and therefore not hybridize).

One strain is a haploid wildtype SERF strain (normal SERF gene),
Three related yeast cultures will be used (coded as YS1, YS2 and YS3) that differ in structure of a specific gene called SERF. NOTE: we are substituting SERF for SQS1 One strain is a haploid wildtype SERF strain (normal SERF gene), One is a haploid that bears a gene disruption (serf::KAN – where the kanamycin resistance gene substitutes replaces the SERF protein coding sequence) One is a heterozygote diploid with both a wildtype and gene disruption allele (SERF/serf::KAN). PCR will be used to distinguish the wildtype culture from that bearing the targeted gene disruption. The predicted sizes of the dsDNA PCR products produced from the wildtype SERF and mutated serf::KAN PCR products are 499 and 1892 bp, respectively. NOTE THAT THESE SIZES DIFFER FROM WHAT IS IN THE LAB MANUAL. The details on the chromosomal deletion strategy can be found at:

Each Group – (three different yeast strains - coded)
Grow a 1.5 ml yeast culture coded YS1, YS2 and YS3) grown to saturation (typically overnight) in rich broth (e.g., YPD = 1% Bacto‑yeast extract, 2% Bacto‑peptone, 2% glucose). Spin out cells in a screw capped microfuge tube (2 min. in the microfuge). Remove all of the supernatant and wash the pellet with 1 ml of sterile water and spin out as before. Wash once with 1-ml ice cold RE buffer (100 mM LiCl, 100 mM Tris‑HCl pH 7.5, 1 mM EDTA). Resuspend the cell pellet in 0.4 ml of cold RE buffer and 150 μl of Tris‑buffered phenol/CHCl3/isoamyl alcohol (PCI, 50:49:1). Add approximately ~2/3 of the cell suspension volume of sterile glass beads (acid washed and siliconized). Before you cap, make sure there are no glass beads on the tube lip – use a kimwipe to brush away any glass beads. Break cells using the vortex mixer, 8 X 30 seconds on high speed (place on ice for 30 seconds between vortexing to keep the solution cold). To reduce cleavage by endogenous nucleases. WORK QUICKLY though the cell breakage step. Spin the sample intermittently 3 minutes at full speed in the microfuge and transfer the upper layer to a fresh tube with 300 μl of PCI. Vortex over a 3 min. period. Spin for 2 min. in the microfuge. Remove the upper (aqueous) layer and extract once more with phenol/CHCl3/isoamyl alcohol. Finally, extract the aqueous layer one last time with chloroform (CHCl3) only (75 μl) . Like the PCI, the chloroform layer sinks to the bottom of the tube.

Transfer the upper (i.e., aqueous) phase to a fresh tube and add 100 μl of 3 M sodium acetate (pH ~ 5.5) and 1 ml of 100% ethanol. Vortex well and then place on dry ice for 5 minutes. Thaw, vortex the sample again and then spin in a microfuge for 8 min., remove all the supernatant, and wash the pellet with 1.5 ml 80% ethanol. Spin 2 min., remove the ethanol Wash again with 80% ethanol, spin 2 minutes and the dry the pellet under vacuum. Resuspend the pellet in 25 μl of sterile H2O. Label: Gp#, DNA YS1 (or YS2, YS3). Freeze on dry ice and then at -80C until use.

We will use a radiation sensitive Typhoon 8600 (GE Corp
We will use a radiation sensitive Typhoon 8600 (GE Corp.) phosphoimager screen to detect the hybridized riboprobe on your membrane(see lab handout). This screen absorbs energy emitted from the beta particle and stores this energy in a chemical form that can later be released as light and read by the Typhoon phosphoimager. The phosphoimager can detect signals over a linear range of at least 5 orders of magnitude (as opposed to X-ray film with is sensitive over 1 to 2 orders of magnitude). The multi-laser Typhoon instrument can also be used to detect a wide range of florescent signals or chemiluminescent signals with varying excitation and emission wavelengths. The specifications of the Typhoon 8600 and the user manual are on the class web site – look these over.

Read class handout

Photostimulated luminescence:
The Phosphoimager storage screens contain crytsals of BarFBr:Eu+2 embedded in an organic matrix. Β particle emitted from the 32-P isotope excites europium (EU+2) electrons into higher orbital. Stimulated electrons are transferred from europium to barium flourobromide (BaFBr) creating oxidized europium (Eu+3) and reduced BaFBr-. This metastable state stores the pattern of 32-P decay for many hours. After the storage screen is exposed for sufficient time ( 5 min to 25 hours depending on how “hot” the sample is), you place it on the phosophoimager platen. 633 nm red light emitted from the Typhoon laser is absorbed by the BaFBr- causing this compound to release electrons that oxidize Eu+3 to the excited state Eu+2*. As the excited Eu+2* returns to its ground state Eu+2, blue light is released. The Phosphoimager scans the entire storage screen records the location and amount of blue light released, saving a digital image of your blot.

Goal: Characterization of a Eukaryotic Gene Steps: Cloning a segment of Saccharomyces cerevisiae (baker’s yeast) DNA into a pair of convenient plasmid vectors, specifically, pTZ18u and pTZ19u, prepare +/- riboprobes and use to detect yeast cellular on a membrane transfer of RNA resolved on a denaturing agarose gel. TODAY 18. Results of northern blot hybridization –Determine the direction of transcription in yeast of this transcript relative to two physical landmarks (the DNA recognition sequences for EcoRI and HindIII) EXPERIMENT #3: Detection of genetic differences using the polymerase chain reaction (PCR) (note, one of several PCR-based experiments used to detect genetic mutations, introduce new DNA mutations, quantify nucleic acid amount in an experimental unknown, detect novel RNA processing events) Isolate total nucleic acid from haploid wildtype yeast (SQS1), from haploid yeast bearing a gene disruption (sqs1::KAN) and from diploid yeast with one of each allele (SQS1/sqs1::KAN) Direct forward PCR to determine the genotypes of the coded YS1, YS2, YS3 Inverse PCR on circular plasmid to delete the F1 viral DNA replication origin from pTZ18u Short quiz If time, introduction to the yeast two hybrid (Y2H) system

The 18u probe was transcribed by T7 RNA polymerase from the EcoRI-> HindIII orientation and the 19u probe transcribes from the HindIII-> EcoRI orientation

Small amount of 28S and 18S rRNA background
GROUP 1 18U 19U * Small amount of 28S and 18S rRNA background Novel yeast transcript The 18u probe was transcribed by T7 RNA polymerase from the EcoRI-> HindIII orientation and the 19u probe transcribes from the HindIII-> EcoRI orientation. What is the orientation of the yeast RNA detected on the membrane? The novel yeast transcript hybridized to the synthetic 19u single stranded riboprobe, so it must be transcribed in yeast in the opposite orientation – Yeast makes this RNA from the EcoRI site to the HindIII site. Restriction sites can act as landmarks in genomic DNA as well as plasmid DNA So, we cloned a piece of yeast genomic DNA, found it has a transcribed gene, and learned its direction of transcription. Next, DNA sequencing will reveal the identity of the gene.

Three basic polymerase chain reaction (PCR) steps
Forward and reverse PCR oligonucleotide primers (also called upstream and downstream primers) base pair with the template DNA (in our case, the yeast genomic DNA) flanking the region to be amplified by a thermostable DNA polymerase.

Polymerase chain reaction (PCR) simply, repeated DNA synthesis
Polymerase chain reaction (PCR) simply, repeated DNA synthesis of a defined sequence of DNA in a test tube. What is “special” – a thermostable DNA polymerase that survives Repeating heating >92C needed To produce single-stranded DNA Template. We are using Taq polymerase Isolated from Thermus aquaticus Which normally grows in the hot Thermal vents of the ocean Forward and reverse PCR ss DNA oligonucleotide primers (also called upstream and downstream primers) base pair with the template DNA (in our case, the yeast genomic DNA) flanking the region to be amplified by a thermostable DNA polymerase.

Common temperatures for:
Denaturation ( C) Annealing (37 – 60C) Extension (68 – 72) The PCR reaction is done in a machine that is, in essence, a heat block that can be programed to rapidly change temperature anywhere over a range between ~ 4C and 100C. Depending on the application, cycles are common. The NEB Long Amp is a mixture of an enhanced Taq DNA polymerase Thermus aquaticus the Deep Vent DNA polymerase Pyrococcus species GB-D. The mixture is made to improve yield (Taq) and fidelity (Deep Vent).

Extension rate is 1,000 to 4,000 bp per minute depending on the DNA polymerase. While 2n tells you the total number of amplified products after each cycle (n), some of these are retain single stranded ends (see products of cycles 1 and 2). Starting with a single DNA molecule, the number of fully ds DNA products with primer-defined PCR sequences at both ends of the molecule is 2n –2n (where n is the number of cycles).

Polymerase Chain Reaction (PCR) – identifying a genotype, creating a gene-specific deletion
Today we will perform the polymerase chain reaction (PCR) on 1) the yeast genomic DNA isolated last week and 2) with purified plasmid DNA (details discussed in class). The PCR reaction simply consists of multiple rounds of DNA synthesis on a predetermined region of your target DNA. The target DNA is located between a pair of synthetic DNA oligonucleotides (oligos) that are: 1) complementary to opposite strands of the target and, 2) oriented with their respective 3' ends towards each other across the target. Taq DNA polymerase is a heat stable enzyme that uses the oligos as primers for DNA synthesis. Each round of DNA synthesis is followed by a high temperature dissociation of the double stranded reaction products. The released single‑stranded reaction products can then bind a new oligo to initiate another round of amplification. For the yeast DNA, the wildtype SERF gene amplification should be 499 bp while the deletion mutant (serf::KAN) is ~ PGMG (Each Student – each group must do all three PCRs; YS1, YS2 and YS3) In one 0.2 ml PCR tube, add 2.0 µl of yeast genomic DNA template (either strain YS1, YS2 or YS3 strain; DNA concentration ~0.1 mg/ml) and 9 µl sterile water This tube already contains: 9.5µl of H2O 2.5 µl 10X NEB Taq buffer 0.5 µl of SERF upstream (or 5') primer*A (0.5 µg of 20‑mer) 0.5 µl of SERF downstream (or 3') primer*D (0.5 µg of 20-mer) 1.0 unit Taq DNA polymerase Mix briefly and spin briefly. Be sure to label the cap of your tube (YS1, YS2, YS3 plus your group number). * final primer concentration ~1 µM 3’ at 95C followed by 30 cycles: 95C (denaturation), 58C (annealing), C (extension)] Sequence of SERF upstream primer (A): 5’ CACTCTGGGGAATGACTAAAATAGA 3’ Sequence of SERF downstream primer (D): 5 AAACTACTGGCACTATTCATTCCAA 3’

Your PCR reaction will produce an amplified region of the yeast genome containing either SERF or serf::KANR . What would you need to do with this PCR product to clone it into pTZ18u cut with SmaI (blunt)? Taq DNA polymerase leaves a 1 base 3’ adenosine single stranded extension that is not encoded by the primers. To get rid of this, treat with a single stranded endonuclease like S1 or mung bean nuclease. The primers used for PCR are generally NOT phosphorylated (have 5’ and 3’ hydroxyls). To add phosphates needed for ligation, use T4 polynucleotide kinase +ATP Typically the DNA fragments are gel purified before cloning to get rid of any aberrant products and residual template DNA. This can be done before or after the enzymatic steps above. Usually your vector is dephosphorylated using calf intestinal phosphatase (or related phosphatase). The blunt dephosphorylated vector and the blunt phosphorylated PCR products are then joined using T4 DNA ligase + ATP. You are now ready for E. coli transformation.

The template is a circular plasmid
Inverse PCR to make a deletion (insertion or bp change). Same as standard PCR except that The template is a circular plasmid The primer pairs flank a region to be deleted and polymerize away from one another. The amplified product is linear and must be re-circularized with T4 DNA ligase before transformation to recover the deletion mutant. Depending on the enzyme used for polymerization, blunting of the PCR product may be needed to remove 3’ non-encoded dA. Inverse PCR can also be used to make base substitutions or insertions in a gene using the same strategy with primers specific for the task.

Inverse PCR to create a deletion
Inverse PCR to create a deletion. Here the PCR reaction will be repeated as above but substituting the original (non-recombinant) pTZ18u. The primers are designed to delete out a 307 bp F1 origin from this CIRCULAR plasmid. After PCR, you will compare the length of the full-length linear plasmid with the amplified DNA which should be shortened by 307 bp. NOTE: While we are using this protocol to fully remove a viral replication origin, the basic inverse PCR strategy can be used to in lots of different contexts, e.g., to remove a single codon from a protein coding sequence, delete an intron region from a gene, remove positive or negative regulatory sequences from a gene, introduce or mutable codon changes, add a new restriction site, etc. The only requirement is to have a circular template and pair of single-stranded oligonucleotides that flank the sequence to be removed. In a 0.2 ml PCR tube, Add 23 µl master mix composed of: 16.25 µl of H2O 0.5 µl of upstream (or 5') primer*F (0.5 µg of 20‑mer) 0.5 µl of downstream (or 3') primer*R (0.5 µg of 20 mer) 5 µl of 5X buffer 0.75 µl of 10 mM dNTP Next add: 1.0 µl (~ 20 ng) of a diluted pTZ18u DNA template (use a 1:10 dilution of a standard plasmid DNA miniprep). NOTE: use the original pTZ18u vector not the recombinant vector. Finally add: 1.0 µl of NEB LongAmp Taq polymerase (~5 units) – mix briefly then place in the thermocycler 3’ at 94C followed by 30 cycles: 94C (denaturation), 45C (annealing), 3 65C (extension)] 1X Buffer = 60 mM Tris-SO4 (pH 9.0 at 25C), 20 mM (NH4)SO4, 2 mM MgSO4, 3% glycerol, 0.06% IGEPAL CA-630, 0.05% Tween 20 (Note: both IGEPAL and Tween are non-ionic detergents) PCR (Polymerase Chain Reaction) amplifies specific segments of DNA from complex mixtures. pTZ18u*F oligo: 5’caaccctatctcggtctattc3’ pTZ18u*R oligo: 5’ cagggcgcgtcccattcgccat3’

Yeast two-hybrid analysis is a way to detect protein-protein interaction in living cells.
The principle is based on creating protein fusions with portions of an artificially bisected transcription factor, Gal4

Gal4 – a natural DNA transcription factor of yeast, needed to transcribe the genes required to metabolize galactose. Like many transcription factors, full length Gal4 protein has a DNA binding domain (BD; bottom) that interacts with the upstream activation sequences of genes needed for galactose metabolism in yeast. Gal4 also has a transcriptional activation domain (AD; top) that binds DNA polymerase to promote transcription. These two protein domains can be separately expressed from two different plasmids – neither one able to stimulate transcription. However, if you “bridge” the interaction through an interacting peptide association you reconstitute the transcription factor.

The Gal4 BD and AD peptides can be separately expressed from two different plasmids – neither one able to stimulate transcription. However, if you “bridge” the interaction by protein-protein interaction through protein fusions of the “bait” and “prey” the two Gal4 halves can stimulate transcription. Prp43 Pxr1 fragment Pxr1 fragment Prp43

We will use the Y2H approach to score for interaction between the Prp43 RNA helicase protein and portions of the Pxr1 helicase activator protein required to stimulate Prp43 activity in rRNA biogenesis.

Full length PRP43 cloned into the pAS2 DNA binding vector which carries the TRP1 gene

Different deletion derivatives of the PXR1 gene cloned into pACT2 (transcriptional activation vector) which carries the LEU2 gene

We will answer the question: What portion of the 271 amino acid Pxr1 protein binds the Prp43 helicase? To do this, we express the full-length Prp43 from pAS2 (BD) and test pACT2 (AD) portions of Pxr1 (see left). Those that activate the GAL1-HIS3 reporter permit the host to grow on medium lacking histidine. The HIS+ transformants identify the Prp43-interacting domain within Pxr1.

interactions within the cell (i.e., in vivo).
Oct 15: Lab 13 Analysis of PCR reactions; Y2H part I (yeast transformation) Reading assignments: PGMG Chapter 11 (pp ); NEB (sample prep for RNA/DNA sequencing). NEB 196 & 355 (Impact system & pTXB1) NOTE: prior Y2H reading assigned Use of PCR Isolation of yeast DNA from wt (SQS1) and sqs1::KAN mutant strains PCR to detect genotypes from mutant, wildtype and heterozygous diploid strains Inverse PCR to create a deletion within pTZ18u plasmid Analysis of genotype-specific PCR and inverse PCR results (gel electophoresis) New Experiment – Use of the yeast two hybrid assay (Y2H) to map protein-protein interactions within the cell (i.e., in vivo). Two types of questions can be asked using the Y2H approach 1) What are the set of cellular proteins that bind my protein of interest? For example, say that you are studying actin function, you might ask what proteins bind actin in the cell. This would be done by a scoring a recombinant DNA library in the Y2H vector backbone for interacting clones 2) What regions (domains) of your favorite protein (e.g., actin) bind an established binding partner (e.g., myosin). That is what part of actin physically touches myosin? This is done my using actin derivatives (parts of the actin gene) expressed in the Y2H backbone for interaction with myosin expressed in a second, Y2H vector

PCR analysis gel (1% agarose)
PCR analysis gel (1% agarose). Before loading gel, transfer your YS1, YS2, YS3 and inverse PCR to clean 1.5 ml tubes. After loading 2µl on the gel, store the remainder in your freezer box. Lane Sample Volume of DNA Volume of Dye 1. YS1 PCR µl 2µl YS2 PCR µl 2µl YS3 PCR µl 2µl 1 kbp DNA 4µl 0 pTZ18u/Eco µl 2µl (note, non-recomb.; Eco/HindIII ok) Inverse PCR#1 2µl 2µl Inverse PCR#2 2µl 2µl For analysis: SERF PCR = 499 bp serf::KAN = 1892 bp pTZ18u/Eco = 2860 bp pTZ18u del F1 origin = 2405 bp

The yeast two-hybrid assay (Y2A) is used to determine whether two proteins interact (bind) one another in a cell. A positive result is sometimes interpreted as showing direct protein-protein interaction but care must be taken in this interpretation there is always a possibility that a third protein “bridges” the interaction. A more cautious interpretation of a positive interaction is that the proteins directly or indirectly (through a complex) associate. A negative result, while suggestive, does not prove lack of interaction but simply provides no evidence for an interaction detectable by this assay.

In our lab, we will investigate the interaction of two yeast proteins, Prp43 and Pxr1. Prp43 is an RNA helicase, defined as an enzyme that uses ATP to separate base paired regions of RNA or dissociates protein bound to RNA. Prp43 enzyme activity is required for 1) the pre-mRNA spliceosome to excise introns from mRNA in the cell and also for 2) the proper processing of the large and small ribosomal RNAs needed for protein translation While more than 300 different proteins participate in these two different RNA processing pathways, both. Prp43 is one of only two proteins common. As such, Prp43 biological activity is said to integrate the two fundamental RNA processing reactions in the cell – pre-mRNA splicing and rRNA biogenesis

The efforts of my laboratory and that of several other groups have demonstrated that the helicase activity of Prp43 is regulated by the binding of a stimulatory factor or activator. There are Prp43 activators known: Spp382 – which stimulates Prp43 in pre-mRNA splicing Sq1s which stimulates Prp43 in rRNA processing (late) Pxr1 - which stimulates Prp43 in rRNA processing (early) Pxr1 is 271 amino acids long and binds directly to Prp43. Our goal is to sub-divide the Pxr1 protein into pieces and determine which region of Pxr1 binds to Prp43. We will do this by cloning the Pxr1 protein coding sequence into the pACT2 Y2H vector and assaying the full length protein and various Pxr1-deletion derivatives (and controls) for interaction with Prp43 expressed by the pAS2 plasmid. Yeast will be selected for successful transformation by both plasmids on medium lacking tryptophan and leucine. Transformants will be subsequently screened for a positive Y2H response (activation of GAL1-HIS3) by growth on medium that lacks histidine.

Yeast two-hybrid analysis is a way to detect protein-protein interaction in living cells.
The principle is based on creating protein fusions with portions of an artificially bisected transcription factor, Gal4

Gal4 – a natural DNA transcription factor of yeast, needed to transcribe the genes required to metabolize galactose. Like many transcription factors, full length Gal4 protein has a DNA binding domain (BD; bottom) that interacts with the upstream activation sequences of genes needed for galactose metabolism in yeast. Gal4 also has a transcriptional activation domain (AD; top) that binds DNA polymerase to promote transcription. These two protein domains can be separately expressed from two different plasmids – neither one able to stimulate transcription. However, if you “bridge” the interaction through an interacting peptide association you reconstitute the transcription factor.

We will use the Y2H approach to score for interaction between the Prp43 RNA helicase protein and portions of the Pxr1 helicase activator protein required to stimulate Prp43 activity in rRNA biogenesis. We will score for Y2H response using the GAL1-HIS reporter gene.

Full length PRP43 cloned into the pAS2 DNA binding vector which carries the TRP1 selectable marker gene.

Different deletion derivatives of the PXR1 gene cloned into pACT2 (transcriptional activation vector) which carries the LEU2 selectable marker gene

Here is a map of the Pxr1 surfaces to be scored against the full-length Prp43 protein. Note, other than the full-length construct labeled “A” (our positive control) all other images show the region of the protein that is removed from the construct to be tested. For instance, construct “B” lacks amino acids of the native protein but has everything else; construct “C” has a larger deletion that extends from amino acid 1 through position 101. The “G-patch” and KKE/D labels refer to specific sequence features of the Pxr1 protein. NOTE: In addition to the constructs below, we will use on that contains only Pxr1 amino acids (called J) and a pACT2 empty vector negative control where these is no Pxr1 DNA (labeled K). We will answer the question: What portion of the 271 amino acid Pxr1 protein binds the Prp43 helicase? To do this, we express the full-length Prp43 from pAS2 (BD) and test pACT2 (AD) portions of Pxr1 (see left). Those that activate the GAL1-HIS3 reporter permit the host to grow on medium lacking histidine. The HIS+ transformants identify the Prp43-interacting domain within Pxr1.

Defining a Protein-Protein Interaction Domain by the Yeast Two-Hybrid (Y2H) Assay, part I. Yeast Transformation Protocol (see PGMG ) Each Group 1. Start off with ~50 ml of a mid to late log growth culture of PJ69-4A yeast (~OD 600 of 1.5 to 3.0) already transformed with pAS2-Prp43 (OD 600 between 2 and 4) grown in YPD medium. 2. Wash the culture twice with 5 ml of Li buffer (100 mM LiOAc, 10 mM Tris pH 7.5, 1 mM EDTA). 3.Spin as before and then resuspend in 3.5 ml of Li buffer – use a sterile 5 ml or a 10 ml pipet, not the pipetman. Each Student 4. Add 500 µl of culture to each 13X100 mm (small) capped glass culture tube. Prepare and label one tube for each DNA to be tested. Be sure to note the specific construct used. 5. Add plasmid DNA (1-3 µg in 10µl), incubate for 5 minutes at room temperature. 6. Add 25 µl of 10 mg/ml salmon sperm DNA (heat denatured for 10 prior to use) 7. Add 25 µl of DMSO incubate 10 minutes at room temperature. 8. Add 2.5 ml of 40% PEG 3000 in Li buffer. Incubate for 30 minutes at 30C. 9. Heat shock at 42C for 15 minutes. 10. Spin out the culture, wash once in 1 ml of sterile (i.e., freshly autoclaved) water. You can vortex to mix the cells. Spin the cells for 5 minutes at full speed in the clinical (tabletop) centrifuge. Pour off the liquid. Vortex what is left in the tube (usually ~ 150 µl of liquid remains) and plate the yeast evenly on selective medium lacking both leucine and tryptophan.

Group 1 – use plasmids A, B, C Group 2 – use plasmids D, E, F,
You can expect transformants per microgram of plasmid DNA. Incubate one plate at 30C. NOTES: 1. Use sterile technique throughout the experiment but do not hold the pipettes over a flame or you will kill the cells. 2. Check to be sure that the water bath is at the right temperature before starting the experiment. 3. Use the clinical centrifuge for all spins. A 5 minute spin at room temperature should be sufficient to pellet the yeast. 4. Be sure that you use water that was recently autoclaved for your washes. Group 1 – use plasmids A, B, C Group 2 – use plasmids D, E, F, Group 3 – use plasmids G, H, I Group 4 – use plasmids J, K

For Wednesday – please read
1) the review of real time PCR 2) the introduction of the iCycler Manual (just the basic description of the machine and its parts – pages 1-5) Both are posted in Canvas

EM image of M13 phage pII (aka p2) nicks the double stranded form of the genome to initiate replication with the help of pX (p10) of the + strand. Host enzymes copy the replicated + strand, resulting in more copies of double stranded phage DNA. pV (aka p5) competes with double stranded DNA formation by sequestering copies of the + stranded DNA into a protein/DNA complex destined for packaging into new phage particles and export out of the cell.

The M13K07 replication proteins (pII, pX) also bind the F1 DNA replication origin of pTZ18u/19u to produce + strand DNA that is sequestered by pV and other phage proteins as “mock viral particles” of single-stranded DNA. The supernatant contains a mixture of single-stranded M13 K07 virus and recombinant pTZ18u or 19u mock viral particles. The ratio of these forms depends on the multiplicity of infection and growth conditions.

pII (aka p2) nicks the double stranded form of the genome to initiate replication with the help of pX (p10) of the + strand. Host enzymes copy the replicated + strand, resulting in more copies of double stranded phage DNA. pV (aka p5) competes with double stranded DNA formation by sequestering copies of the + stranded DNA into a protein/DNA complex destined for packaging into new phage particles and export out of the cell. The M13K07 replication proteins (pII, pX) also bind the F1 DNA replication origin of pTZ18u/19u to produce + strand DNA that is sequestered by pV and other phage proteins as “mock viral particles” of single-stranded DNA.

Goals: Use of PCR to a) identify gene variants, b) validate mRNA deep sequencing results, and c) measure nucleic acid abundance 1. Identify gene variants. Isolate genomic DNA from haploid yeast strains with 1) a wildtype SQS1 gene 2) a sqs1::KAN gene disruption and from a diploid strain with both at SQS1 and sqs1::KAN allele. Use the polymerase chair reaction (PCR) to amplify the genomic DNA from a haploid WT yeast (SQS1), a haploid sqs1::KAN mutant and heterozygous diploid made by mating each haploid parent SQS1/ sqs1::KAN. The predicted size PCR fragments are 2963 bp (SQS1) and 2243 bp (sqs1::KAN) which will be used to determine which of the coded yeast strains contain the wildtype and mutant SQS1 alleles. Inverse PCR to generate a site-specific deletion (mutation) of plasmid pTZ18u. We will remove the 307 bp F1 origin of ssDNA replication. Consequently, the inverse PCR product will produce a DNA fragment of 2553 while the orignal vector is 2860 bp. Discussion of Yeast Two-Hybrid (Y2H) Experiment 5. Agarose gel electrophoresis of your 1) coded yeast genomic DNA preparations and 2) deletion mutant of recombinant-pTZ18u created by inverse PCR 6. Yeast Two-Hybrid Experiment – transformation of the PJ69-4A (pAS2-PRP43) host with 10 derivatives of the PXR1 gene as GAL4 (activation domain) protein fusions on plasmid pACT2. 7. Analysis of the prp38-1 genetic complementation experiment by wildtype PRP38 introduced by yeast transformation in strain ts192. Questions related to Wednesday’s exam Today 8. Affinity purification of a recombinant protein: IPTG induction of the SPP382(codons 1-121)-intein-chitin binding domain gene on plasmid pTXB1 9. Yeast Two-Hybrid Analysis of protein-protein interaction: Patch transformants onto master –leu, -trp plates (selects only for the plasmids, not reporter gene activation) and subsequent Y2H interaction analysis. Note how “red” the colonies are compared to that of other students. 10. Measuring nucleic acid abundance by real time PCR

First thing…….. Induce expression of the recombinant protein.
Each group designates on member student A and one member student B Student A raise your hand. Find the 50 ml culture tube that says pTXB1-empty Find the microfuge tube of 50 mM IPTG Add 100 μl of the 50 mM IPTG to the pTXB1-empty tube then bring the tube to the front of the room. Student B -Find the 50 ml culture tube that says pTXB1-Spp382 (1-121) and add 100 100 μl of the 50 mM IPTG then bring the tube to the front of the room

Protein fusion vectors
Common Features: Basic plasmid backbone with origin of replication and selectable marker for E. coli. “Extra” DNA sequence adjacent to a cloning site that encodes a protein for which some tool (e.g., antibody, chromatography reagent, etc.) is available for specific recovery of the protein fusion by affinity selection. When two affinity tags are added in parallel, a tandem affinity purification (TAP) is possible which generally yields much higher purity. A protease or otherwise cleavable site located between the affinity tag and the protein of interest is commonly included to permit the release of the tag after recovery, resulting in the purification of a protein with a native (or nearly so) amino acid sequence. Purification of the released peptide away from the protease may be required, depending upon the application.

Purification of a recombinant protein using a protein fusion approach
The protein we will purify is the N-terminal portion, the first 121 amino acids, of yeast splicing factor Spp382. Spp382 is similar to Pxr1 in that Spp382 binds the Prp43 enzyme to stimulate the Prp43 ATPase and RNA unwinding (helicase) activities. A protein fusion approach is when you use a recombinant DNA approach to produce a modified gene designed to synthesize a mRNA that encodes your protein of interest (here Spp ) extended with additional amino acids which can be used for protein purification. We have fused Spp382(1-121) to sequences encoding the chitin binding domain (CBD) peptide. The chitin binding domain has high affinity for chitin which we can purchase bound to agarose beads. Binding of Spp382(1-121)CBD to chitin is selective and we can thus purify this protein away from the other E. coli proteins by this selective interaction After selecting Spp382(1-121)-CBD to chitin, the Spp382 (1-121) portion can be released from CBD by protein cleavage using an intein sequence located between the CBD and the Spp382 (1-121) segment. So, the actual protein fusion made in E. coli is of three different segments produced as ONE single protein, Spp382(1-121)-intein-CBD.

Our plasmid has the first 121 codons of the yeast SPP382 gene, encoding an essential subunit of the spliceosome fused to the Mxe intein fused to the chitin binding domain. The product is a single protein composed of these 3 parts. Spp382(121)-intein-CBD

Chitin is a polysaccharide found in the outer skeleton of insects, crabs, shrimp, and lobsters and in the internal structures of other invertebrates & yeast. Chitin is composed of ß(1-4) linked units of the amino sugar N-acetyl-glucosamine.

But what is an intein? A intein is a naturally occurring self-excising peptide that removes itself from the initial protein product to form a mature protein. This is processing at the protein-level that is conceptually similar to splicing at the RNA-level.

The intein directs an autocatalytic protein cleavage event.
Today we will simply induce transcription of our SPP382(codons 1-121)-intein-chitin binding domain fusion gene with IPTG. In subsequent labs we will break the cells and recover the recombinant protein on chitin-agarose. The intein directs an autocatalytic protein cleavage event. CHAPS (3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate) – gentle organic zwitterion detergent with both a positive and negatively charged group at neutral pH. Disrupts membranes and helps solubilize proteins without denaturing proteins.

NEB – Impact System – Chitin binding protein fusion
Plasmid vector pTXB1 (NEB #N6707) The target protein is fused at its C-terminus to a self-cleavable intein tag (~28 kDa) that contains the chitin binding domain (CBD, 6 kDa) allowing for affinity purification of the fusion precursor on a chitin column. Question: The promoter for this 3-part fusion gene is transcribed by the T7 RNA polymerase but where does the polymerase come from?

E. coli host strain ER2566 : fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) endA1 Δ(mcrC-mrr)114::IS10) fhuA2 iron uptake deficiency (gene adjacent to McrBC) lon – mutant in lon protease (activator of other cell proteases) – stabilizes foreign proteins ompT - mutant in outer membrane protease VII – stabilizes foreign proteins lacZ::T7 gene1 –IPTG inducible T7 RNA polymerase gene – needed for pTXB1 expression. Note, that this gene is artificially transcribed by the lac Z promoter induced by IPTG sulA11 – mutant in a negative regulator of cell division (promotes growth in lon mutant background) R(mcr-73::miniTn10--TetS)2 transposable element mutation to mcrA endonuclease nuclease – stabilizes foreign DNA Δ(mcrC-mrr)114::IS10). Complex mutation of the McrC and Mrr endonuclease genes – stabilizes foreign DNA endA1 – mutation in the endA endonuclease stabilizes foreign DNA [dcm] R(zgb-210::Tn10--TetS) – transposable element mutation of dcm methylase

Today – simply stimulate transcription of the T7 promoter driven copy of spp382(1-121)-intein-CBP [we will use the shorthand pTXB1-SPP382(1-121)] by IPTG induction Part 1. Induction of protein synthesis. The pTXB1 fusion gene is expressed from a T7 RNA polymerase dependent promoter. We will use the E. coli strain ER2566 as a host since this strain contains the bacteriophage T7 RNA polymerase under the control of an IPTG-inducible promoter (ER2566 Genotype: fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10--TetS)2 [dcm] R(zgb-210::Tn10--TetS) endA1 Δ(mcrC-mrr)114::IS10). An overnight culture of the pTXB1-SPP382 (1-121) and the empty pTXB1 was diluted 1/100 in LB-ampicillin medium 2.5 hours before class. You will induce gene expression by: 1) addition of 100 µl of a freshly made 50 mM IPTG solution to the 10 ml bacterial culture (final concentration = 0.5 mM IPTG). Likewise add the same amount of IPTG to second culture contains the empty vector pTXB1. Incubate the cultures at 30C with vigorous shaking until 4:30 PM. In addition to the induced cultures. Christen will prepare two control cultures without IPTG addition as “uninduced” controls for the pTXB1-SPP382 (1-121) and the empty vector. At that 4:30 pm, concentrate the cells in the centrifuge (10 minutes at 5000 rpm). Pour off the medium and freeze the cell pellets on dry ice and store at -80C until the next meeting.

So, for the class as a whole, the PCR experiment use successful in
Purification and use of yeast genomic DNA for PCR allele identification Creation of a pTZ18u deletion derivative that lacks the F1 origin Remember, Taq-based PCR leaves products with one extra adenosine at the 3’ end of each strand. This single nucleotide addition prevents the product from self ligating. Our inverse PCR was done with non-phosphorylated oligos and used a Taq-based polymerase. What three enzymatic steps need to be performed before our inverse PCR could be introduced into E. coli for recovery of the desired deletion derivative?

An alternate way to clone a PCR product having an A tail
Many (but not all) thermostable DNA polymerases have a terminal deoxynucleotide transferase activity that adds a single non-encoded dA to the 3’ ends of the PCR product. This must either be removed with a 3’->5’ exonuclease (often Klenow or T7 DNA polymerase) or, in the case of a simple PCR fragment, cloned into a vector having a complementary extra dT. The latter is called TA cloning. You can purchase linear dT extended vectors but these are expensive – how might you make your own?

To reduce unexpected “background” bands in PCR
Nested PCR can be used to amplify products where secondary sites of primer annealing give unwanted PCR products. Nested PCR simply means two sequential standard PCR experiments. First with the primers flanking the DNA of interest and genomic DNA. This produces a mixed product but one where the complexity is greatly reduced from the whole genome. Next, the products of the first PCR reaction are used as the template for a second PCR experiment with new oligonucleotide primers that bind (are “nested) within the desired product. This round of PCR produces the single product.

* * * YS1,2,&3 gel, inverse PCR – GROUP 3
Deletion strategy worked. What you do before transformation if you want to recover this clone? I will trouble shoot the PCR so that we can re-do to distinguish between the WT haploid and the heterozygous diploid in lanes 2 and 3. SERF PCR ~ 500 bp and found in both the WT haploid AND the SERF/serf::KAN diploid serf::KAN ~ 1800 and in the Serf::KAN haploid mutant AND the SERF/serf::KAN diploid For some reason the serf:KAN –specific PCR failed to give bands. Which strain is in lane 1? Lane 2 and 3? Lane 1: YS1 SERF or serf:KAN Lane 2: YS2 YS1 SERF or serf:KAN Lane 3: YS3 YS1 SERF or serf:KAN Lane 4: 1kb ladder Lane 5: 18U cut with EcoRI Lane 6: Inverse 1 deletion of F1 sequence Lane 7: Inverse 2 deletion of F1 sequence

Real time PCR is a way of quantifying the amount of RNA or DNA in a sample. It involves the same basic chemistry or standard PCR but includes a reagent that allows one to measure the amount of product produced. There are multiple reagents that can be used, we will use Sybr green. This compound fluoresces brightly only when bound to double-stranded DNA.

The real time PCR machine has a sensor that measures florescence
The real time PCR machine has a sensor that measures florescence. More and more dsDNA is made through each PCR cycle, so the amount of florescence increases with each cycle. This can be used to create a standard curve of DNA amount vs florescence. The threshold (PCR) cycle represents the point in which enough ds DNA is present to make the florescence greater than background due to the unbound dye. When the PCR threshold cycle occurs depends upon the amount of DNA in the original sample. The more originating DNA, the earlier the threshold cycle. The amount of DNA in a sample of unknown concentration can be determined by discovery of its threshold cycle and comparing this to the standard curve prepared using controls of known DNA amounts.

Each group will: 1) prepare a dilution series SQS1 DNA for use as a standard curve. Each dilution will be used in a PCR experiment (student A) 2) prepare the master mix PCR solution and do a PCR reaction with SQS1 DNA of unknown concentration (student B) Biorad iCycler – similar to the myCycler we previously used except that it has optics and software to monitor and record florescence in real time for each well of the microtiter dish holding the samples.

7X plus Master Mix (purchased from Bio-Rad)
Student A Set up dilutions of your starting control DNA template. Your stock DNA is at a concentration of 20 ng/µl. Start by putting 9 µl of sterile water into 4 microfuge tubes. THEN Transfer 1 µl of the 20 ng/ µl DNA to the next dilution tube containing 9 µl of water , mix and label this 2 ng/µl. Next transfer 1 µl of the 2 ng/ µl DNA to the next dilution tube containing 9 µl of water , mix and label this 0.2ng/µl. Next transfer 1 µl of the 0.8 ng/ µl DNA to the next dilution tube containing 9 µl of water mix and label this 0.02 ng/µl. Finally transfer 1 µl of the 0.02 ng/ µl DNA to the next dilution tube containing 9 µl of water mix and label this ng/µl. STOP HERE AND CAREFULLY READ THE AMOUNT OF DNA FROM EACH DILUTION TO USE Student A) - Carefully pipet exactly 24 µl of the 7X Master Mix (prepared by student B) into 5 PCR tubes labeled 20, 2, 0.2, 0.02 and 0.002 -Transfer 1µl of your 20.0 ng/ 1µl DNA STOCK = (20 ng PCR) -Transfer 1µl of your 2.0 ng/ 1µl DNA = (2 ng PCR) -Transfer 1µl of your 0.2 ng/ 1µl DNA = (0.2 ng PCR) -Transfer 1µl of your 0.02 ng/ 1µl DNA = (0.02 ng PCR) -Transfer 1µl of your ng/ 1µl DNA = (0.002 ng PCR) BE SURE TO LABEL EACH OF YOUR FIVE PCR TUBES

Student B in each group*. Set up7X Master Mix: Add the following in order:
34.0 µl sterile water 75.0 µl 2X iQ Sybr green supermix (100 mM KCl, 40 mM Tris-HCI, pH 8.4, 0.4 mM of each dNTP (dATP, dCTP, dGTP, and dTTP, 50 units/ml iTaq DNA polymerase, 6 mM MgCl2, SYBR Green I, 20 nM fluorescein, and stabilizers). 17.5 µl 5 uM Primer 1(SQS1 G patch F – 20 mer) 17.5 µl 5 uM Primer 2 (SQS1 G patch R – 20 mer) Mix briefly. Student B in group (DNA of unknown concentration) Pipet 24 of the 7X Master Mix into 1 fresh microfuge tube. Add 1 µl of your DNA template of known concentration, mix and label “unknown” Mix briefly and transfer your samples into the microtiter dish using the coordinates the TA provides.

Oct 22: Lab 15 Y2H part II (streak plates originally in from lab 14); Isolation of a recombinant protein part II, (cell lysis & affinity selection); Discussion of real time PCR results Reading assignments: PGMG Chapter 6 gene cloning strategies, Homework due. Note: Short quiz on Wednesday (from material starting October 12th). Also, since we will go to the microarray facility on Friday, we will introduce microarray design and use and the Nanostring Technology for RNA measurements on Wednesday.

We will use the Y2H approach to score for interaction between the Prp43 RNA helicase protein and portions of the Pxr1 helicase activator protein required to stimulate Prp43 activity in rRNA biogenesis.

FROM Lab 14 Yeast Two-Hybrid (Y2H) Assay, part II. The yeast double-transformants will be scored for reporter gene trans-activation using medium lacking histidine. This medium also contains 5 mM 3-aminotrizole (3-AT) which is a competitive inhibitor of the HIS3 encoded imidazole glycerol-phosphate dehydratase enzyme. 3-AT addition “tightens” the selection by making growth dependent on higher levels of HIS3 reporter gene transactivation. A positive interaction (i.e., growth) is interpreted as indicating that Prp43 interacts with the region of Pxr1 included in that particular pACT2plasmid.

HIS3 encodes the enzyme imidazole glycerol-phosphate dehydratase
D-erythro-1-(imidazol-4-yl)glycerol 3-phosphate (natural HIS3 enzyme substrate – enzyme removes water) 3-aminotriazole (3AT) – a competitive inhibitor of His3 catalysis

Each student will streak for single colonies from one colony of their double transformant and one colony each of the same yeast host transformed with the full-length pACT2-PXR1 (positive control – plasmid A) or the pACT2-empty vector (negative control) on –histidine +5 mM 3-AT agar medium. To confirm that the yeast are viable, we will also streak the same yeast strains on –leucine, -tryptophan agar medium (which selects for the plasmids but does not require reporter gene trans-activation). Incubate all plates at 30C. NOTES: Each group had between 3 and 5 different plasmids to transform with each student transforming 2 or three plasmids. You should streak colonies (on the two different media types) from the transformation you conducted PLUS the positive and negative control. If your transformation tube broke, obtain a colony of the same transformant from the second student using that plasmid Before you start, draw lines on the back of your plate to separate the plate into 6 quadrants. Use as many of these as you need.

Labe each quadrant before you streak.
Patch a small amount of yeast with a sterile toothpick in the upper left portion of a quadrant, Flame the loop, then streak 1/3 the way down; Flame the loop a second time and streak another 1/3 of the quadrant – overlapping a bit of the previous streak Flame the loop a third time and steak the final 1/3 of the quadrant– overlapping a bit of the previous streak pAct2-empty Each group will use 2 –trp, -leu plates and 2 –his +3-AT plates Each group will streak the three cultures they transformed PLUS the positive control (strain A, full length Pxr1) and the negative control (strain K, empty plasmid vector)

Yeast Two-Hybrid (Y2H) Assay,
Question: We sometimes find that certain recombinant pACT2 or pAS2 transformants grow less well on –trp, -leu media than others. For instance, yeast transformed with either pACT2-SPP382 or pAS2-SPP382 grown more slowly on such media compared with the same vector fused to PXR1. What might account for this difference in growth even in the absence of reporter gene activation? Question: Some yeast colonies are red and some are white; why is this and does the color difference relate to the Y2H assay? Yeast Two-hybrid Host Strain PJ69-4A MATa trpl-901 leu2-3,112 ura3-52 ade2 his3-200 ga14 Δ ga18OΔ GALl-HIS3 GAL2-ADE2 GAL7-lacZ Mutations in the ade2 gene result in the intracellular accumulation of a red-colored intermediate in adenine biosynthesis. pJ69-4a is an ade2 mutant and therefore is red. However, pJ69-4A also has a GAL2-ADE2 reporter gene that will complement the ade2 mutation if the transformed plasmids result in a positive Y2H interaction. So, the color provides a hint on which transformants are likely to grow on the –his+3AT medium.

Affinity purification of a recombinant protein
IPTG induction of the SPP382(codons 1-121)-intein-chitin binding domain gene on plasmid pTXB1 Lyse the induced ER2566 transformants with the empty vector (pTXB1) or recombinant plasmid pTXB1-Spp382 Isolate the Spp382-intein-chitin binding domain protein by chitin-agarose affinity selection Stimulate intein cleavage and Spp382-release from the chitin-agarose beads with dithiothreitol (DTT) activation of the intein.

Purification of a recombinant protein: protein extraction and affinity selection. Today we will break the E. coli cells by mechanical (freeze/thaw) and chemical means then take cleared supernatant and bind the released proteins to chitin-agarose beads. Non-specifically bound proteins will be dissociated by a high salt wash and then the proteins specifically bound to the chitin-agarose will be released by DTT-stimulated intein cleavage for subsequent analysis by polyacrylamide gel electrophoresis. Resuspend your cell pellet in 400 µl of the B-PER protein extraction reagent (see lab web page) and vortex vigorously. B-PER contains a proprietary zwitterion (has both positive and negative charges) detergent that facilitates cell lysis. Another example of a common zwitterion detergent used for protein isolation is CHAPS (3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate). Structure of CHAPS

Transfer the cell solution to a microfuge tube
Transfer the cell solution to a microfuge tube. Protein recovery is favored by efficient cell breakage & this is made better by cycles of freezing and thawing. Place on dry ice until the solution freezes solid (5 minutes). Next, thaw by warming the tube between your fingers and shaking. Repeat the freeze/thaw cycle one more time. Next, add 2 µl (1 unit per microliter) of DNase I and incubate the cell mixture at 25C (room temperature) for 15 minutes. Spin for 5 minutes at full speed in the microfuge and carefully transfer 350 µl of the supernatant to a fresh tube. Discard the cell pellet. Place 20 µl of the supernatant into a fresh microfuge tube with the blue protein sample buffer and label Total-vector or Total-Spp382 (with your initials and the date) – put these tubes into the dry ice until next lab period. Transfer the remaining 330 µl of cell lysate supernatant to the tube containing the 50 µl of a 50% suspension of chitin agarose (a 50% suspension means equal amounts of settled beads and free liquid) washed in 20 mM Hepes pH 8.5; 500 mM NaCl, 1 mM EDTA. Label this tube as Bound Induced-Spp382 or Bound Induced-vector depending on which sample you are doing. Rotate the tubes for 30 minutes at room temperature. IMPORTANT NOTE: To accurately transfer the chitin agarose we must cut off the top of a P-200 pipetman tip to make it wide enough to transfer the agarose beads. Also, be sure that you are gentle mixing and centrifuging the beads, otherwise you will lose chitin from the beads.

Spin the tubes at 4,000 RPM for 15 seconds
Spin the tubes at 4,000 RPM for 15 seconds. It is very important that adjust your microfuge to spin at this lower speed – spinning at full speed will damage the chitin agarose beads. Carefully remove the supernatant and gently resuspend (do NOT vortex) the agarose beads in 1 ml of the high salt wash buffer (20 mM Hepes pH 8.5; 500 mM NaCl, 1 mM EDTA). Invert the tubes 3X and then spin as before at 4,000 RPM and remove the supernatant. Repeat the wash twice more (for a total of 3 washes) with 1 ml each of the wash solution. Wash once with 0.5 ml low salt cleavage buffer (20 mM Hepes pH 8.5; 25 mM NaCl, 50 mM DTT). Spin the tubes at 4,000 RPM for 15 seconds then remove final wash and resuspend the beads in100 µl of fresh low salt cleavage buffer with DTT. Mix gently and then incubate the sample overnight at room temperature. Tomorrow, the TAs will then refrigerate the sample at 4C until the next lab period.

The real time PCR machine has a sensor that measures florescence
The real time PCR machine has a sensor that measures florescence. More and more dsDNA is made through each PCR cycle, so the amount of florescence increases with each cycle. This can be used to create a standard curve of DNA amount vs florescence. The threshold (PCR) cycle represents the point in which enough ds DNA is present to make the florescence greater than background due to the unbound dye. When the PCR threshold cycle occurs depends upon the amount of DNA in the original sample. The more originating DNA, the earlier the threshold cycle. The amount of DNA in a sample of unknown concentration can be determined by discovery of its threshold cycle and comparing this to the standard curve prepared using controls of known DNA amounts.

PCR Standard Curve Report with PCR Amp Cycle Graph
PCR Base Line Subtracted Curve Fit Data Current Date: 18-Oct-18 11:05 AM Data generated on: 17-Oct-18 at 05:19 PM. Optical data file name: Data 17-Oct opd Plate Setup file used: Rymond BIO 510 plate.pts Protocol file used: Rymond BIO 510 .tmo Sample volume: ul Hot Start? No Well factor collection: Experimental Plate Protocol Cycle 1: ( 1X) Step 1: ºC for 02:00 Cycle 2: ( 40X) Step 1: ºC for 00:30 Step 2: ºC for 00:30 Data collection enabled. Step 3: ºC for 00:45 Data collection and real-time analysis enabled. Cycle 3: ( 1X) Step 1: ºC for 01:00 Cycle 4: ( 80X) Step 1: ºC for 00:15 Increase setpoint temperature after cycle 2 by 0.5ºC Melt curve data collection and analysis enabled. Cycle 5: ( 1X) Step 1: ºC HOLD

Standard Curve Graph for SYBR-490
PCR Amp/Cycle Graph for SYBR-490 Standard Curve Graph for SYBR-490

The highest DNA samples (20 ng) for group 1 and 3 did not work.
Threshold cycle Amount in nanograms Standard Curve Spreadsheet Data for SYBR Units: nanograms Type Identifier Rep Ct Log SQ SQ SQ Ct Ct Set SQ Mean SD Mean SD Point A02 Standard E E+01 N/A N/A A03 Standard E E+00 N/A N/A A04 Standard (1.000) 1.00E E-01 N/A N/A A05 Standard (2.000) 1.00E E-02 N/A N/A A06 Unknown E E+01 N/A N/A B01 Standard E E+02 N/A 9.92 N/A B02 Standard E E+01 N/A N/A B03 Standard E E+00 N/A N/A B04 Standard (1.000) 1.00E E-01 N/A N/A B05 Standard (2.000) 1.00E E-02 N/A N/A B06 Unknown E E+00 N/A N/A C02 Standard E E+01 N/A N/A C03 Standard E E+00 N/A N/A C04 Standard (1.000) 1.00E E-01 N/A N/A C05 Standard (2.000) 1.00E E-02 N/A N/A C06 Unknown E E+00 N/A N/A D01 Standard E E+02 N/A 9.73 N/A D02 Standard E E+01 N/A N/A D03 Standard E E+00 N/A N/A D04 Standard (1.000) 1.00E E-01 N/A N/A D05 Standard (2.000) 1.00E E-02 N/A N/A D06 Unknown E E+00 N/A N/A A01 Standard N/A N/A N/A N/A N/A N/A N/A C01 Standard N/A N/A N/A N/A N/A N/A N/A The highest DNA samples (20 ng) for group 1 and 3 did not work. All nanogram values should be multiplied by “2” (since I mistakenly entered 10, 1, 0.1, 0.01 and for the standards rather than 20, , 0.02 and 0.002)

Melt Curve Single sharp peak ~79.5C indicates a success in a single PCR product being amplified

The DNA sequences below are listed by student initials
The DNA sequences below are listed by student initials. Find your sequence and then do a BLAST search on SGD ( ). Click on the “Genome Browser) link on the BEST MATCH sequence (that with the most similarity to your DNA sequence to identify the gene you cloned. Click on the bar directly below the sequence in the genome browser window to identify the gene name and function Group 1 Charles CGTCGCGTGCAGCTTCTGAATGAAGAATAGAAGCATGAAACTTTAAAAGTTTCAGTACTTTAAGAAAGAAATAAATAGAAAAATGTTCCATTTATTTCTGAAAATAAATCAAAAATTATAAGATCCACCCGTTCCTACCAAGACCTTCCAAAATTTTTCCCATAACGGGAACGAGCAAAGTTGAGACTGCTCAAAAGAGCACATCTTCAAACTACAATCCCGACCAAATAATCTCAACAGCCATACCTTCATCATAAACTTAAGTTCATTCGAATCTGCCGTCAAAAACTAAAATGGCACGCTAGAGAAAAGTAGTCAAAAAGAATGCCTCTACAAAGCTCTCTTTTGAAAGGCCCCAGCTCCCCTAACACCAATTTGAATTTGGTGTCAAACTTCTCCAGGCAGAAGAAACAAAGGGCCCCAAAAATCAGTTTAACCCAAAAATCCCCAAAGGAATCAAGGGATTAACCAATGATTGAAACAAGGGAATGGAAACGTCAGCAAACACGCCTTCCGCGCCGTATGTGTGTGTGACCAAGGAGTTTGCATCAATGACTTCAATGAACAATTATAGTTCAATGATAAATGCTTAACGTCCTTCTACTATTGGAAGCGCATGTTTGATCAGTAGGACTTCTTGATCTCCTCTGATATCTTAAGGTAAGTATGAATTCCCTATAGTGAGTCGTATTAAATTCGTAATCATGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCCCGTTGCTG Group 1 Brad CGTCGCAGTGCAGCTTCTGAATGAAGAATAGAAGCATGAAACTTTAAAAGTTTCAGTACTTTAAGAAAGAAATAAATAGAAAAATGTTCCATTTATTTCTGAAAATAAATCAAAAATTATAAGATCCACCCGTTCCTACCAAGACCTTCCAAAATTTTTCCCATAACGGGAACGAGCAAAGTTGAGACTGCTCAAAAGAGCACATCTTCAAACTACAATCCCGACCAAATAATCTCAACAGCCATACCTTCATCATAAACTTAAGTTCATTCGAATCTGCCGTCAAAAACTAAAATGGCACGCTAGAGAAAAGTAGTCAAAAAGAATGCCTCTACAAAGCTCTCTTTTGAAAGGCCCCAGCTCCCCTAACACCAATTTGAATTTGGTGTCAAACTTCTCCAGGCAGAAGAAACAAAGGGCCCCAAAAATCAGTTTAACCCAAAAATCCCCAAAGGAATCAAGGGATTAACCAATGATTGAAACAAGGGAATGGAAACGTCAGCAAACACGCCTTCCGCGCCGTATGTGTGTGTGACCAAGGAGTTTGCATCAATGACTTCAATGAACAATTATAGTTCAATGATAAATGCTTAACGTCCTTCTACTATTGGAAGCGCATGTTTGATCAGTAGGACTTCTTGATCTCCTCTGATATCTTAAGGTAAGTATGAATTCCCTATAGTGAGTCGTATTAAATTCGTAATCATGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAAAAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCCCGTTGCA

Affinity purification of a recombinant protein
IPTG induction of the SPP382(codons 1-121)-intein-chitin binding domain gene on plasmid pTXB1 Lyse the induced ER2566 transformants with the empty vector (pTXB1) or recombinant plasmid pTXB1-Spp382 Isolate the Spp382-intein-chitin binding domain protein by chitin-agarose affinity selection Stimulate intein cleavage and Spp382-release from the chitin-agarose beads with dithiothreitol (DTT) activation of the intein. Recover the eluted Spp382 (1-121), the intein-CBP bound to the agarose and resolve samples on a 15% polyacrylamide SDS gel. Defining a Protein-Protein Interaction Domain by the Yeast Two-Hybrid (Y2H) Assay Overview of Y2H approach, yeast host strain, plasmids and reporter genes Transformation of yeast pJ69-4a, pAS2-PRP43 with a set of pACT2 plasmids containing portions of the PXR1 gene fused to the Gal4 activation domain; selection on –leucine, -tryptophan medium Patch the pJ69-4a, pAS2-PRP43 , pACT2-PXR1 (fragment) double transformants on –leucine, -tryptophan medium for storage Score for Y2H interaction of the the pJ69-4a, pAS2-PRP43 , pACT2-PXR1 double transformants by streaking for single colonies on –histidine medium supplemented with 5 mM 3-aminotriazole (3AT). 3AT is a competitive inhibitor of the enzyme encoded by the HIS3 reporter gene, Imidazoleglycerol-phosphate dehydratase. The 3AT makes the assay more sensitive by demanding greater GAL1-HIS3 transcription for growth. We will also streak on –leu, -trp plates to confirm that all cultures are viable. Data analysis Discussion of microarrays and Nanostring technologies Short Quiz

Purification of a recombinant protein: sample analysis – Part III
Purification of a recombinant protein: sample analysis – Part III. Today we will recover your recombinant protein Spp382(1-121), and characterize our purity and yield by discontinuous polyacrylamide gel electrophoresis (PAGE). The proteins will be resolved on a 15% polyacrylamide gel (29:1 acrylamide to bisacrylamide) resolving gel with a 4% stacking gel and the gel stained for proteins using Coomassie blue dye. Recombinant Protein Recovery: Spin the chitin agarose beads with your pTXB1 empty vector and the pTXB1-Spp382 (1-121) sample at 4,000 rpm for 2 minutes and then transfer the supernatant to a fresh tube containing 100 µl of protein sample buffer. Label this as ELUTED Spp382 or ELUTED –Empty. Place the samples on ice. For the Spp382 beads only (the vector beads can be discarded at this time), Add 1ml of low-salt bead wash buffer ((20 mM Hepes pH 8.5; 25 mM NaCl) to the tube and invert several times. Next, spin the beads at 4,000 rpm for 2 minutes then remove the supernatant with a pipetman. Repeat this wash step two more times to remove any of the intein-released material that no longer is bound via the chitin-agarose link. Remove the final wash from the beads and resuspend the bead pellet in 50 µl of protein sample buffer. Label this as BOUND sample. We anticipate that what remains on the beads is the chitin-binding domain-intein segment for both the pTXB1 empty vector preparation and the pTXB1-Spp382 (1-121) preparation (the latter assuming complete intein-cleavage). Place a cap sealer on all tubes and heat all samples at 100C for 10 minutes. Remove the tubes from heat but do not put on ice. After 10 minutes remove the whole block (with the glass lid) and allow to incubate at room temperature for ~10 minutes before removing the tubes. Vortex the samples briefly, then spin in the microfuge at full speed for one minute. Load gel (left to right) with 20 microliters of each sample:

Load gel (left to right) with 20 microliters of each sample:
Lane Sample Total uninduced pTXB1 vector only (Christen) Total uninduced pTXB1-Spp382 (1-121) (Christen) NEB Broad Range Protein markers (15 ul) (Christen) Total induced Spp382 group 1 Eluted control group 1 Eluted Spp382 group 1 Bound sample group 1 Total induced Spp382 group 2 Eluted control group 2 Eluted Spp382 group 2 Bound sample group 2 Total induced Spp382 group 3 Eluted control group 3 Eluted Spp382 group 3 Bound sample group 3 Total induced Spp382 group 4 Eluted control group 4 Eluted Spp382 group 4 Bound sample group 4

Results pACT2-construct Y2H activation (visible colonies) pACT2-empty pACT2-A PACT2-B pACT2-C PACT2-D pACT2-E PACT2-F pACT2-G PACT2- H pACT2-I PACT Where is the Prp43 binding site in Pxr1?

Prenylation is the posttranslational addition of an isoprenoid moiety to a cysteine near the C-terminus of a substrate protein. The isoprenoids typically added are:

Where aliphatic = A, V, I, L, G
The consensus sequence is a C-terminal C[aliphatic][aliphatic]X motif. Where aliphatic = A, V, I, L, G C[AVILG][AVILG]X>

Total Hits 23 Number of Unique Sequence Entries Hit Sequences Searched 5916 Dataset Translations of all standard S.c. ORFs (Protein)

Prenylation typically occurs on proteins destined to anchor on biological membranes. Examples in include a number of GTPases involved in signal transduction associated with the cell cycle or intracellular protein trafficking. The addition of the isoprenoid moiety allows membrane attachment and (often) activation of the protein’s biological activity.

inactive active Ras proteins function as binary molecular switches that control intracellular signaling networks. Ras-regulated signal pathways control such processes as actin cytoskeletal integrity, cell proliferation, cell differentiation, cell adhesion, apoptosis, and cell migration.

Measuring mRNA abundance RNA Detection Strategies on Global Scale
Northern blots, RNase mapping and quantitative reverse transcriptase PCR (rtPCR) are useful for detecting and quantifying RNAs in biological samples. These approaches are most useful when you are scoring a minor subset of the cells RNA (e.g., less than a few dozen transcripts) What do you do when you want to assay the many thousands of RNAs in a cell to learn, for example, how gene expression differs between a cancer cell and a normal cell? cell/tissue/organism before and after viral infection? cell/tissue/organism after exposure for a hormone, a toxin, etc.? RNA Detection Strategies on Global Scale DNA microarrays Nanostring technology Massively parallel (deep) sequencing of transcriptome

DNA microarrays – What are they
DNA microarrays – What are they? In essence, small glass slides with a multitude (tens of thousands to millions) of gene-specific DNA sequences printed on the surface. Can be used as a vastly parallel norther blot. Can be used for multiple purposes, including a. to measure differences in RNA abundance between two samples b. to detect the presence of alternative splice forms of processed mRNA c. to identify DNA polymorphisms or mutations in genomic DNA d. sequencing DNA (less common today)

Two basic sorts of DNA microarrays:
Printed cDNA arrays (much less common today) Affymetrix arrays These are distinguished by: how the probes are prepared, the length of the DNA probes bound to the glass slide, the use of competitive (printed arrays) vs non-competitive (Affymetrix) hybridization approaches the computer software used for analysis sensitivity, versatility and cost NOTE: A short overview paper on DNA microarray technology is posted on the class website – this is a good time to read it.

Printed Arrays: Cloned genes or cDNAs generally covalently linked to a chemically activated glass surface using robotic equipment to spray or drip DNA solution into defined spots. Probes often >100 bp in length but can be shorter or longer for specific applications. Technique: Cellular mRNA from two sources (e.g., healthy cells and cancerous cells) is converted to cDNA using to different fluorescently labeled nucleotides (e.g., Cy3 [green] and Cy5 [red]. The relative red/green signal for any given gene tells whether any specific mRNA abundance is higher, lower or the same in the healthy and cancer tissue. Once the probes are made, can be less expensive than the Affymetrix system. Sensitivity & specificity considered lower than with the Affymetrix array – single nucleotide polymorphisms (SNP) and other small changes are generally more difficult to monitor.

While still occasionally used for specific purposes, printed arrays are generally considered old technology

Affymetrix Arrays: The individual ssDNA “probes” are chemically synthesized on the slide by light activated lithography according to the sequence provided by the investigator. The probes are short (~25 nts) and each gene is represented by multiple (10-20 typical) different oligomers from different regions of the gene – concordance among the spots in the hybridization results bolsters confidence that the hybridization signals are authentic. Careful probe design is critical! What factors do you think are considered important for probe design? Control probes corresponding to the same gene regions but containing a mismatch (mutation) are included to achieve specificity (that is, the mismatch signal is considered background and subtracted from the corresponding spot without the mismatch). Other control probes can include duplicates of authentic gene probes and probes from sequences not present in the organism in question.

First ds cDNA is against cellular mRNA made using rtPCR.
Each slide is hybridized with biotin-substituted cRNA prepared from only one of the two sources (e.g., healthy or cancerous tissue). In the microarrays, the synthetic oligonucleotides covalently bound to the slide are called the probes. Detection of the probes is done with antisense RNA to the probes. This is done in two steps. First ds cDNA is against cellular mRNA made using rtPCR. Second, this cDNA is used for in vitro transcription of the antisense RNA (cRNA) using a T7 promoter built into the oligonucleotide primers used in cDNA synthesis. The cRNA incorporates biotin substituted UTP during synthesis for subsequent detection This step done by in vitro transcription using a T7 promoter built into the PCR primers

Fragmentation of biotinylated cRNA

Hybridization and Staining
Array Fragmented cRNA Target RNA:DNA Hybridized Array Streptavidin phycoerythrin [Fluorescent dye] binds biotin on the cRNA to provide the “signal” of mRNA abundance

Each slide is hybridized with biotin-substituted cRNA prepared from only one of the two sources (e.g., healthy or cancerous tissue). The hybridization signals are measured independently on the two slides with a fluorescently labeled streptavidin molecule (which binds biotin) and then the data are normalized to overall signal levels and compared to determine the relative differences in individual spot intensity (which transcripts increase, which decrease, which stay the same). The Affymetrix (GeneChip) arrays are also good for single nucleotide polymorphism SNP genotyping.

Bioinformatics: Downstream computational analysis for both types of arrays
GOAL: Define sets of transcripts that increase, decrease or stay the same. Cluster genes that act in a similar manner & seek evidence for correlative function based on bioinformatics (similarities in encoded products structure, function, associations) to define novel pathways

Variations on the standard microarray experiment are commonly used to:
1) detect single nucleotide polymorphisms (SNPs) associated with genetic disorders in infants and adults (clinical application) 2) the frequency of alternative pre-mRNA splicing(or alternative 5’ or 3’ end) isoforms in a mRNA population 3) Detection of viral or bacterial pathogens (or any nucleic acid containing environmental feature) in biological samples (blood, water, etc.)

Nanostring Technology – a second technology to measure RNA abundance
NOTE: Review of Nanostring Technology on the class web site.

Nanostring Technology
Advantages: - Multiplex up to 800 different mRNA targets - High sensitivity - a detection limit between 0.1 fM and 0.5 fM, and a linear dynamic range of over 500-fold - No nucleic acid amplification required - Minimal sample requirement (100 ng of RNA or entire experiment only ~ 10 cells worth can detect ~1 mRNA copy per cell) - Direct use of multiple sample types including total RNA, cell lysate, and whole-blood lysate Disadvantages – cost & limits on the number of genes that can be assayed simultaneously How would you choose which probes to make? What criteria would you consider important for the 1) genes to be identified and 2) the sequence characteristics of the probes purchased?

Deep Sequencing analysis
Deep Sequencing analysis. Confirmation of Novel Introns and Alternative Pre-mRNA splice site choice in yeast predicted by Illumina deep sequencing “Deep sequencing” of a transcriptome refers to the application of high throughput or “next generation” sequence analysis of an RNA population. Such sequencing approaches provide valuable information on 1) the abundance (within a population or when comparing RNA samples from a control and experimental RNA sample) and 2) the structure of RNAs (e.g., alternate splice sites, alternate transcriptional start sites, alternate 3’ poly A addition sites). Novel or otherwise RNAs are often reported from such studies. The lab web site has two reviews on next generation sequencing strategies, several of which we will be able to observe “in action” when we visit the University of Kentucky Advanced Genetics Technologies Center (AGTC) this semester.

We previously identified multiple yeast genes with previously unknown mRNA splicing patterns using the Illumina-based sequencing technology. These data suggest the presence of cryptic introns within reported “intronless” genes and the use of unexpected alterative 5’ or 3’ splice sites in genes known to have an intron. Such observations are interesting since regulated RNA processing is a basic means of regulating gene expression. However, one should rule out experimental artifacts by confirming the observation using an independent methodology. We will do this by making a cDNA library form the total yeast RNA (of the wildtype strain) and then using PCR to validate the presence of two novel splice products predicted by our Illumina sequencing study.

Lab 17 Deep sequencing verification analysis, part I – Note: this is another student-requested lab for cDNA synthesis & rtPCR: We will use Quanta-bio first strand synthesis kit. A PDF file that describes this system is on the lab web site and is required reading. NOTE: all buffers are listed in this PDF you should copy these into your lab notebook. The protocol below includes minor modifications from the suggested protocol for lab class convenience. Each Student: FIRST - Label your PCR tube (sides and bottom) with your initials. The PCR tube (on ice) already has 4 µl of the Quanta-bio reaction mix (with reverse transcriptase, dNTPs, buffer and oligo dT) Add: 4 µl of DNase I-treated total yeast RNA (0.5 µg) 12 µl of sterile water Mix briefly then spin at 2,000 rpm to collect the liquid in the bottom of the tube. To spin, place the PCR tube inside of a standard microfuge tube that you have cut off the cap. Bring the PCR tube to the front of the room and run the following: 25C – 5 minutes 42C – 30 minutes 85C – 5 minutes 4C – hold -> -80C Freeze the cDNA on dry ice and store at -80 until next lab period. NOTE: The TA will do the “minus reverse transcriptase” (–RT) class control by going through an equivalent temperature set without the enzyme mixture.

Mutation: -6.8 kJ/mole (initial)
Wildtype: kJ/mole ΔG = ΔH – TΔS Change in Gibbs free energy = change in enthalpy minus temperature X change in entropy The wildtype tRNA has a lot more thermodynamically favorable structures (24 out of 30, 80%) with most structures having a negative delta G including a -12kJ/mole 8 base pair helix and a -10kJ/mole 5 base pair helix. The mutated tRNA has less intermolecular interactions with a higher ratio of positive delta G structures (5 out of 20, 25%) including very unfavorable haripin loops of 5.3 and 3.9 kJ/mole. The wildtype tRNA also has a few loops that are unfavorable but it should more likely form spontaneously overall because of the other very favorable helices.

Presence of stabilizing stems or destabilizing loops and bulges
Considerations for stability: Greater number of base paired interactions with G/C favored over A/U or G/U Presence of stabilizing stems or destabilizing loops and bulges Favored base stacking interactions (adjacent bases on the same strand) ΔG = ΔH - TΔS

You need to annotate this image
You need to annotate this image. Label the gel lanes (and tell what was loaded in each) plus label the major bands (the Spp382(1-121)-intein-CBD precursor, the Spp332(1-121) peptide and the intein-CBD peptide. The broad range molecular weight markers sizes are shown at the left.

Bring your protein samples to the front of the room in the order shown below.
Lane Sample Total uninduced pTXB1 vector only Total uninduced pTXB1-Spp382 (1-121) NEB Broad Range Protein markers (15 ul) Total induced Control group 1 Total induced Spp382 group 1 Eluted control group 1 Eluted Spp382 group 1 Bound sample group 1 Total induced Control group 2 Total induced Spp382 group 2 Eluted control group 2 Eluted Spp382 group 2 Bound sample group 2 Total induced Control group 3 Total induced Spp382 group 3 Eluted control group 3 Eluted Spp382 group 3 Bound sample group 3 NEB Broad range markers

Validation of Novel RNA Processing Events Observed by ILLUMINA-based Sequencing of Yeast RNA
13 billion bases from 82 million paired-end cDNA end reads we aligned 68 million cDNAs to the S. cerevisiae genome using Novocraft novoalign V software. MapSplice* filtering (Wang et al., 2010) was used to screen out likely sequence and alignment artifacts. MapSplice considers both the quality and diversity of read alignments and is not dependent on splice site features or intron length, allowing for the detection of non-canonical splicing events. We identified 94% (268 total) of the previously detected transcripts spliced in mitotic cells. Preliminary analysis of the data provides evidence for low-level splicing in 23 genes not previously shown to have an intron and evidence for alternative splice site choice in roughly 25% of all known intron-bearing genes - 81 instances of novel alternative splice site use were found. This level of alternate splice site selection greatly exceeds previous estimates in yeast and includes many examples of novel 5’ splice sites, alternative 3’ splice sites, and combined alternative 5’ and 3’ splice sites. The levels of the alternatively processed RNA varies greatly, from <1% to >30% of the major splice product and, as might be anticipated, most alternative 5’ or 3’ splice site junctions are close matches to the authentic splice site in sequence composition and location. * Wang et al., Nucleic Acids Res. 2010

Chrom: Yeast chromosome where the gene is located
Start/end: beginning and end of the intron ORF: Open reading frame designation (unique identifier for yeast genes; YBL093 = Yeast; 2nd chromosome; Left of the centromere; 93 ORF from the centromere) Gene: common name of gene Exp: relative expression level (Low, Medium, High) Alt. site: alternate 5’ splice site, 3’ splice site or both Flank: 2 nucleotides of exon sequence before and after intron In SGD? Was this annotated in the Saccharomyces cerevisiae genome database at the time of the experiment? Ares 4.1: Was this annotated in the Dr. Manny Ares database at the time of the experiment? WT depth: Number of times the sequence occurs in the wildtype yeast H218A depth: Number of times the sequence occurs in the prp43H218A mutant yeast We will score for the new intron in YMR147W and for the alternative 3’ splice site in IWR1

Deep sequencing verification analysis, part I – Note: this is another student-requested lab for cDNA synthesis & rtPCR: We will use NEB Protoscript II first strand synthesis kit. A PDF file that describes this system is on the lab web site and is required reading. NOTE: all buffers, dNTP concentrations are listed in this PDF you should copy these into your lab notebook. Each Student: FIRST - Label your tube) with your group number and initials. The RNA tube (on ice) already has 4 µl of DNase I-treated total yeast RNA (0.5 µg) Add: 2 µl of sterile water 2 µl of oligo dT Mix briefly then spin to collect the liquid in the bottom of the tube. Incubate at 65C for 5 minutes in order to denature RNA secondary structure. After the 5’ at 65C transfer to the ice for 2 minutes. Spin briefly to collect the liquid in the bottom of the tube then add: 10 µl of the Reaction mix (Rx mix; buffered solution with dNTPs) 2 µl reverse transcriptase (bring your tube to Christen for the enzyme) Mix, spin briefly then incubate at 42C for 60 minutes Heat inactivate the enzyme at 80C for 5 minutes then place on ice in the front of the room. The cDNA will be stored at -70C until used. Christen will do the “minus reverse transcriptase” (–RT) class control by going through an equivalent temperature set without the enzyme mixture. This control will be used to check the effectiveness of the DNase treatment of RNA.

Plasmid Shuffle to learn of a mutated gene copy is functional or not.
The plasmid shuffle is a common way to test whether particular mutation on a cloned gene inactivates (or other ways alters) the function of that gene. To do this, we need a strain of yeast with the following characteristics: a chromosomal mutation that fully inactivates an essential “gene of interest” (here we will use a spp382::KAN null mutant), and chromosomal mutations in at least two genes that can be used for plasmid selection (here we will use ura3 and leu2 mutations). In addition, this strain will be is simultaneously transformed with two different plasmids (that is, two plasmids in the same cell). One plasmid (here called N19) will have a functional copy of the URA3 selectable marker (which complements the ura3 chromosomal mutation) plus a fully functional copy of the gene of interest (here, SPP382). The second “test” plasmid based on the YCplac111 backbone (see: ) each of which contains the LEU2 selectable marker (to complement the chromosomal leu2 mutation. The constructs we will test for function include:

Untransformed yeast host strain: Mat α ura3∆0, leu2∆0, spp382::KAN
Plasmids Used: N19 (URA3 and functional GAL1-SPP382-4); YCplac111 (LEU2 with or without SPP382 derivative. YCplac111 (vector only) (negative control, no second copy of SPP382) YCplac111-SPP382 (wildtype gene) YCplac111-spp382ΔG (mutant spp382 that lacks a 50 codon glycine rich domain) YCplac111-spp382-SQS1 (spp382 mutant in which the “G” patch domain from another protein, Sqs1 has been substituted) YCplac111-spp382-PXR1 (spp382 mutant in which the “G” patch domain from another protein, Pxr1 has been substituted)

URA3-SPP382(N19), YCplac111 LEU2, SPP382
URA3-SPP382(N19), YCplac111 LEU2, spp382ΔG URA3-SPP382(N19), YCplac111 LEU2, spp382-SQS1 URA3-SPP382(N19), YCplac111 LEU2, spp382-PXR1 Pandit and Rymond, Proc Natl Acad Sci U S A Sep 12; 103(37): 13700–13705. The G-patch is ~ 48 amino acid domain in the 708 amino acid Spp382 splicing factor which interacts with and activates the Prp43 helicase. Proteins Pxr1 and Sqs1 also have a G-patch domain and interact with Prp43 – but are the G-patch domains equivalent (can they be swapped)?

The URA3 enzyme converts 5-FOA into the toxic metabolite 5-fluorouracil which kills yeast independent of whether uracil is present in the medium or not. Yeast with a functional URA3 gene die in the presence of 5-FOA. In our case, URA3 is on a plasmid (N19). Cells that have spontaneously lost the N19 plasmid lack the URA3 gene lack orotidine-5'-phosphate decarboxylase activity and grow on 5-FOA medium as long as the essential nutrient uracil is present. Growth on 5-FOA shows which SPP382 derivative (wildtype, G-patch deletion or chimera) on plasmid YCplac111is functional. Question? Does 5-FOA cause plasmid loss? Question? How does “spontaneous” loss occur? Natural substrate: orotidine-5'-phosphate 5-fluoro-orotic acid (5-FOA) used for selection 5-fluorouracil – toxic metabolite of 5-FOA

Oct. 31: Lab 18 Revisit Y2H plates after extended growth (confirmation) Initial Inspection of the plasmid shuffle (FOA) results Validation of deep sequencing predictions- part II, rtPCR step Preparation of single-stranded DNA PGMG Chapter 7, pages ; (DNA sequencing) Homework due,

Results pACT2-construct Y2H activation (visible colonies) pACT2-empty(K) - pACT2-A + PACT2-B + pACT2-C + PACT2-D - pACT2-E - PACT2-F + pACT2-G + PACT2- H - pACT2-I + PACT (J) +

Today we will simply induce transcription of our SPP382(codons 1-121)-intein-chitin binding domain fusion gene with IPTG. In subsequent labs we will break the cells and recover the recombinant protein on chitin-agarose. SPP382(1-121) The intein directs an autocatalytic protein cleavage event. CHAPS (3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate) – gentle organic zwitterion detergent with both a positive and negatively charged group at neutral pH. Disrupts membranes and helps solubilize proteins without denaturing proteins.

Denaturing 15% polyacrylamide SDS gel
NEB Broad Range Protein markers (15 ul) 1. NEB Broad Range Markers 2. Total induced Control group 1 3. Total induced Spp382 group 1 4. Eluted control group 1 5. Eluted Spp382 group 1 6. Bound sample group 1 7. Total induced Control group 2 8. Total induced Spp382 group 2 9. Eluted control group 2 10.Eluted Spp382 group 2 11. Bound sample group 2 12. Total induced Control group 3 13. Total induced Spp382 group 3 14. Eluted Spp382 group 3 15. Eluted control group 3 16. Bound sample group 4 17. NEBmarkers (15 ul) Denaturing 15% polyacrylamide SDS gel Can you describe the structures of each of the bands you see? Intein-CBD band? Spp382 (1-121) band? Spp382-intein-CBD band?

The only lanes missing from what we planned are the total uninduced empty vector and recombinant transformants (lanes 1 & 2). Note, the smaller bands ran off the first gel since the polyacrylamide concentration was actually <15%

URA3-SPP382(N19), YCplac111 LEU2, SPP382
The question you want to answer is whether any of the test plasmids which encode the Spp382 G-patch deletion or chimeric derivative genes can support life. To answer this question, you need to determine whether or not yeast can live without the URA3-based plasmid, N19, which contains a functional SPP382 gene. This can be done by streaking the culture for single colonies on medium containing 5-fluoro-orotic acid. We will streak the same cultures on standard agar medium to demonstrate that all cultures are initially viable. Streak for single colonies yeast cultures containing the following plasmids on the FOA medium and on –Leu – Ura galactose medium URA3-SPP382(N19), YCplac111 LEU2, SPP382 URA3-SPP382(N19), YCplac111 LEU2 URA3-SPP382(N19), YCplac111 LEU2, spp382ΔG URA3-SPP382(N19), YCplac111 LEU2, spp382-SQS1 URA3-SPP382(N19), YCplac111 LEU2, spp382-PXR1 To confirm viability, repeat the streaking on a –ura – leu galactose plate

-L-U +FOA URA3-SPP382(N19), YCplac111 LEU2, SPP382 URA3-SPP382(N19), YCplac111 LEU2 URA3-SPP382(N19), YCplac111 LEU2, spp382ΔG URA3-SPP382(N19), YCplac111 LEU2, spp382-SQS1 URA3-SPP382(N19), YCplac111 LEU2, spp382-PXR1

Deep Sequencing analysis
Deep Sequencing analysis. Confirmation of Novel Introns and Alternative Pre-mRNA splice site choice in yeast predicted by Illumina deep sequencing. To score for new introns and alterative 3’ splice sites, today we will use PCR to amplify the yeast cDNA that you prepared during the last lecture. LABEL the tube with your group number and the first three letters of the gene to be amplified (new intron, YMR147W, 3' Alt Splice site: IWR1,). Each group should do both PCR reactions (one per student in 2-student groups) Each group does two PCR reactions (one student does YMR147W and one student does IWR1). Label your tubes with group number AND gene Add the following in a 0.2 ml PCR tube in the following order. 9 µl of sterile water 12.5 µl Q5 NEB High-Fidelity PCR 2X Master Mix (already in the PCR tube) 1 µl of a 1:1 mix of one upstream + downstream gene-specific specific primer mix (100 nM; YMR147W or IWRI) 2 µl of your cDNA preparation Mix briefly, shake/tap to bring the liquid to the bottom of the tube, then put in the PCR block. Cycle: 3’ at 98C followed by 35 cycles of: 98C 72C Followed by 10’ at 72C and a hold cycle at 10C until the sample is removed from the machine. Christen will run a PCR from the no reverse transcriptase control.

pTZ18u, pTZ19u– made for high copy DNA amplification, RNA transcription, ds DNA AND ssDNA production. M13 bacteriophage – a single stranded circular filamentous virus

M13 pII (aka p2) nicks the double stranded form of the genome to initiate replication with the help of pX (p10) of the + strand. Host enzymes copy the replicated + strand, resulting in more copies of double stranded phage DNA. pV (aka p5) competes with double stranded DNA formation by sequestering copies of the + stranded DNA into a protein/DNA complex destined for packaging into new phage particles and export out of the cell where a different protein set is acquired M13K07 replication proteins (pII, pX) also bind the F1 DNA replication origin of pTZ18u/19u to produce + strand DNA that is sequestered by pV and other phage proteins as “mock viral particles” of single-stranded DNA.

The M13K07 replication proteins (pII, pX) also bind the F1 DNA replication origin of pTZ18u/19u to produce circular + strand DNA that is sequestered by pV and other phage proteins as “mock viral particles” of single-stranded DNA. The culture supernatant contains a mixture of single-stranded M13 K07 virus and recombinant pTZ18u or 19u mock viral particles. The ratio of these forms depends on the multiplicity of infection and growth conditions. M13K07 – a recombinant form of M13 that includes the kanamycin resistance gene

The purification of ssDNA from pTZ vectors
SS DNA Isolation - Each Student 1. Spin 1.5 ml of cells at 5,000 rpm for 5 minutes in the microfuge (be sure to keep track of whether you are using the 18U or 19U) to remove any remaining E. coli. Each group should do one pTZ18u and one pTZ19u 2. Carefully transfer 1 ml of the supernatant (NOT the pellet) a fresh microfuge tube. Label this tube as SS, group # and initials. Cover the label with clear plastic tape (to prevent the ink from running off). 3. Add 300 μl of 20% PEG 8,000/3.5 M ammonium acetate. Mix very well (important) by inversion multiple times. Incubate on ice for 15 minutes. 4. Spin at full speed in the microfuge for 10 minutes. Carefully remove and discard the supernatant with a pipetman tip. Spin the tube briefly again (1 minute is fine) to collect the remaining supernatant & carefully remove the remaining supernatant. NOTE: The pellet is what you want but it will likely be invisible. 5. Add 300 μl of TE to the pellet and vortex to mix. 6. Add 300 μl of TE buffered phenol and 30 μl of 10% SDS and vortex intermittently over a full 10 minute period (do not rush this step). 7. Spin at full speed in the microfuge for 5 minutes and then transfer the supernatant to a fresh tube. NOTE: this phenol is colorless and the organic/aqueous phase may be difficult to see.

The purification of ssDNA from pTZ vectors
SS DNA Isolation - Each Student 8. Add 300 μl of PCI to the sample and vortex intermittently over a 5 minute window. 9. Spin as before and transfer the supernatant to a fresh tube with 100 μl of chloroform. Vortex intermittently over a 5 minute window. 10. Transfer the supernatant to a fresh tube and add 50 μl of 3M sodium acetate and 700 μl of 100% ethanol. Vortex well and then place on ice for 5 minutes. 11. Spin at full speed in the microfuge and then CAREFULLY remove the supernatant with a pipet tip (do not pour out the ethanol). 12. Add 1 ml of 80% ethanol, mix by inverting the tube several times and then spin again for 3 minutes. 13. Carefully remove the ethanol then dry the pellet in the vacuum dryer 14. Resuspend the pellet in 10 μl of sterile water and store at -70C until needed (place in dry ice at the front of the room).

Plasmid Shuffle to learn of a mutated gene copy is functional or not.
YCplac111 (vector only) (negative control, no second copy of SPP382) YCplac111-SPP382 (wildtype gene) YCplac111-spp382ΔG (mutant spp382 that lacks a 50 codon glycine rich domain) YCplac111-spp382-SQS1 (spp382 mutant in which the “G” patch domain from another protein, Sqs1 has been substituted) YCplac111-spp382-PXR1 (spp382 mutant in which the “G” patch domain from another protein, Pxr1 has been substituted)

Goals: Use of PCR to a) identify gene variants, b) validate mRNA deep sequencing results, and c) measure nucleic acid abundance 1. Identify gene variants. Isolate genomic DNA from haploid yeast strains with 1) a wildtype SQS1 gene 2) a sqs1::KAN gene disruption and from a diploid strain with both at SQS1 and sqs1::KAN allele. Use the polymerase chair reaction (PCR) to amplify the genomic DNA from a haploid WT yeast (SQS1), a haploid sqs1::KAN mutant and heterozygous diploid made by mating each haploid parent SQS1/ sqs1::KAN. The predicted size PCR fragments are 2963 bp (SQS1) and 2243 bp (sqs1::KAN) which will be used to determine which of the coded yeast strains contain the wildtype and mutant SQS1 alleles. Inverse PCR to generate a site-specific deletion (mutation) of plasmid pTZ18u. We will remove the 307 bp F1 origin of ssDNA replication. Consequently, the inverse PCR product will produce a DNA fragment of 2553 while the orignal vector is 2860 bp. Discussion of Yeast Two-Hybrid (Y2H) Experiment 5. Agarose gel electrophoresis of your 1) coded yeast genomic DNA preparations and 2) deletion mutant of recombinant-pTZ18u created by inverse PCR 6. Yeast Two-Hybrid Experiment – transformation of the PJ69-4A (pAS2-PRP43) host with 10 derivatives of the PXR1 gene as GAL4 (activation domain) protein fusions on plasmid pACT2. 7. Analysis of the prp38-1 genetic complementation experiment by wildtype PRP38 introduced by yeast transformation in strain ts192. Questions related to Wednesday’s exam 8. Affinity purification of a recombinant protein: IPTG induction of the SPP382(codons 1-121)-intein-chitin binding domain gene on plasmid pTZB1 9. Yeast Two-Hybrid Analysis of protein-protein interaction: Patch transformants onto master –leu, -trp plates (selects only for the plasmids, not reporter gene activation) and subsequent Y2H interaction analysis. Note how “red” the colonies are compared to that of other students. Measuring nucleic acid abundance by real time PCR 11. Analysis of the real time PCR results to measure the concentration of an unknown sample of DNA Validate mRNA deep sequencing results indicating novel splicing events– create cDNA library of yeast mRNA Use cDNA library as DNA template for analysis of YMR147W (new intron) and IWR1 (3' alternative splice site) TODAY 14. Resolve rtPCR products on a 5% polyacrylamide gel to score for novel splicing events 15. Resolve ssDNA on 1% agarose gel 16. Random mutagenesis of plasmid DNA with nitrous acid

Record your observations
Record your observations. Which of the following formed colonies on the FOA plate (indicating growth in the absence of the URA3-SPP382 (N19 plasmid)? Last week This week URA3-SPP382(N19), YCplac111 LEU2, SPP URA3-SPP382(N19), YCplac111 LEU2 - URA3-SPP382(N19), YCplac111 LEU2, spp382ΔG - URA3-SPP382(N19), YCplac111 LEU2, spp382-SQS1 - URA3-SPP382(N19), YCplac111 LEU2, spp382-PXR1 - Pandit and Rymond, Proc Natl Acad Sci U S A Sep 12; 103(37): 13700–13705. The G-patch is ~ 48 amino acid domain in the 708 amino acid Spp382 splicing factor which interacts with Prp43. Proteins Pxr1 and Sqs1 also have a G-patch domain and interact with Prp43 – but are the G-patch domains equivalent (can they be swapped)?

Highlight of our G-patch study on SGD in May, 2015

The URA3 enzyme converts 5-FOA into the toxic metabolite 5-fluorouracil which kills yeast independent of whether uracil is present in the medium or not. Yeast with a functional URA3 gene die in the presence of 5-FOA. In our case, URA3 is on a plasmid (N19). Cells that have spontaneously lost the N19 plasmid lack the URA3 gene lack orotidine-5'-phosphate decarboxylase activity and grow on 5-FOA medium as long as the essential nutrient uracil is present. Prediction: FOA+ colonies will lack URA3 and therefore be unable to grow on medium without uracil. Natural substrate: orotidine-5'-phosphate 5-fluoro-orotic acid (5-FOA) used for selection 5-fluorouracil – toxic metabolite of 5-FOA

To test this prediction, take cells from each of the strains supporting growth the 5 FOA plates onto one plate that lacks uracil (-ura –leu galactose plate). This means one colony form the YCplac111-Spp382 and one from the YCplac111-Spp382-Sqs1 Include as positive controls the original (that is, before FOA selection) URA3-SPP382(N19), YCplac111 LEU2, SPP382 and a negative control, BY4742 which lacks a functional URA3 gene (genotype: MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0). For this assay to work well, you want to patch the yeast lightly (that is, transfer a small amount of the colony, not a big “gob”) and then streak the patch with a flamed loop for single colonies. Incubate the plates at 30C.

Resolution of single stranded circular plasmid DNA – our substrate for chemical mutagenesis
How does this migrate relative to the dsDNA form of the same plasmid? Run a 1% agarose gel loaded as follows: Lane sample amount (µl) 1 1 kbp NEB DNA ladder 4 2 ds uncut plasmid DNA (pTZ19u or 18u) 2 (plus 2 µl dye) 3) ss plasmid DNA (pTZ18u) 2 (plus 2 µl dye) – student 1 4) ss plasmid DNA (pTZ19u) 2 (plus 2 µl dye) – student 2 5) mix of ss-pTZ18u/19u* 5 (plus 2 µl dye) – student 1 * put 2 µl sterile water in a microfuge tube. Add 1 µl ss-pTZ18u, 1 µl ss-pTZ19u and 1 µl 5X NEB buffer CutSmart buffer. Heat at 65C for 5’ and then on the benchtop for 20 minutes. Spin briefly and load the entire sample on the gel (plus dye).

Analysis of rtPCR, Confirmation of Novel Introns and Alternative Pre-mRNA splice site choice in yeast predicted by Illumina deep sequencing. Today you will resolve your PCR products on a 6% polyacrylamide gel in tris-borate, EDTA (TBE) buffer. The added 8% glycerol in the gel (not the buffer) helps the short PCR fragments focus into sharp well-resolved bands. Run 5 µl of your PCR fragment with 2 µl of DNA dye, mix and load the full sample Gel Order Lane Sample TA - YMR147 TA- IWR1 Hi/Lo Extended DNA marker Student 1, group 1 YMR147 Student 2, group 1 IWR1 repeat for rest of student samples Run 100 volts. Run until the bromophenol blue dye is near the bottom & xylene cyanol about midway (~4 hrs). Stain with EtBr and image/photograph under short wavelength UV light.

New Experiment: Random Mutagenesis with Nitrous Acid.
New Experiment: Random Mutagenesis with Nitrous Acid. One way to rapidly identify essential residues within a protein (or regulatory features in a DNA or RNA) is to induce random changes then take the mutagenized pool and assay for changes that meet your desired screen goals (e.g., loss of function, enhanced enzymatic activity, altered substrate selection, etc.). Random mutations can be introduced by a variety of means (e.g., purposely error-prone PCR, use of E. coli “mutator” strains with defects in DNA synthesis or repair, chemical mutagenesis of naked DNA or cells). Here we will use nitrous acid to randomly mutagenesis pTZ18u plasmid DNA in vitro and score for lacZ mutations by the loss of β-galactosidase activity. Nitrous acid deaminates cytosine and adenine resulting mostly in GC->AT; AT->GC transition mutations.

Deamination: Nitrous Acid as a mutagen
Nitrous acid (HNO2), which acts as a mutagen by deamination of the NH2 group of adenine and/or cytosine to an ether group, thus altering their base pairing. After replication, the chemically altered bases are replaced by the mutated residue (G/*C ->A/T or A*/T->G/C). ( ). Single-stranded DNA is much more sensitive to nitrous acid mutagenesis than double stranded DNA. Hence, we will use non-recombinant pTZ18u, our original cloning vector, prepared as single-stranded DNA as you did in class.

Mutagenesis (adapted from Klippel et al. , 1988, EMBO J
Mutagenesis (adapted from Klippel et al., 1988, EMBO J. 7: ) EACH STUDENT Add 10 µl of a 0.1 µg/µl of single stranded pTZ18u preparation to 100 µl of freshly prepared (critical) 250 mM sodium acetate pH 4.4, 1M sodium nitrite (NaN02; which forms nitrous acid under these conditions). Incubate at room temperature. At times for 5 and, 20 minutes remove 30 µl and place in a labeled tube with [30 µl of 3M sodium acetate, pH 8.5, 40 µl sterile water, and 300 µl ethanol]. Put on dry ice for 5 minutes then spin 5 minutes full speed in the microfuge. You can keep the 5 min time point in dry ice until the 20 min. time is ready Carefully remove & dispose of the ethanol in the NaN02 waste container in the hood. Add 1 ml of 80% ethanol. Spin for 3 minutes in the microfuge. Remove the wash ethanol as before and place in the waste container. Repeat the wash step a second time with another 1 ml of 80% ethanol. Spin, dispose of the wash and then dry your sample in the speedvac (you can wait until both the 5 minute and 20 minute samples are available). Resuspend the dried, mutagenized DNA in 10 µl of sterile water and freeze until used for transformation into E. coli. Note: Christen will do a class control performed as above for 5 and 20 minutes but in the absence of added sodium nitrite. These controls will be used to determine the background of Amp+, lacZ- plasmids as well estimate as the % inactivation (i.e., loss of transformation ability) of plasmid DNA due to the mutagenesis procedure. Conduct this work in the hood – two students can work simultaneously. Work quickly but carefully! BE SURE to place the pipet tips and the excess reagent in the specially marked dry and liquid waste containers.

1. Identify gene variants. Isolate genomic DNA from haploid yeast strains with 1) a wildtype SQS1 gene 2) a sqs1::KAN gene disruption and from a diploid strain with both at SQS1 and sqs1::KAN allele. Use the polymerase chair reaction (PCR) to amplify the genomic DNA from a haploid WT yeast (SQS1), a haploid sqs1::KAN mutant and heterozygous diploid made by mating each haploid parent SQS1/ sqs1::KAN. The predicted size PCR fragments are 2963 bp (SQS1) and 2243 bp (sqs1::KAN) which will be used to determine which of the coded yeast strains contain the wildtype and mutant SQS1 alleles. Inverse PCR to generate a site-specific deletion (mutation) of plasmid pTZ18u. We will remove the 307 bp F1 origin of ssDNA replication. Consequently, the inverse PCR product will produce a DNA fragment of 2553 while the orignal vector is 2860 bp. Discussion of Yeast Two-Hybrid (Y2H) Experiment 5. Agarose gel electrophoresis of your 1) coded yeast genomic DNA preparations and 2) deletion mutant of recombinant-pTZ18u created by inverse PCR 6. Yeast Two-Hybrid Experiment – transformation of the PJ69-4A (pAS2-PRP43) host with 10 derivatives of the PXR1 gene as GAL4 (activation domain) protein fusions on plasmid pACT2. 7. Analysis of the prp38-1 genetic complementation experiment by wildtype PRP38 introduced by yeast transformation in strain ts192. Questions related to Wednesday’s exam 8. Affinity purification of a recombinant protein: IPTG induction of the SPP382(codons 1-121)-intein-chitin binding domain gene on plasmid pTZB1 9. Yeast Two-Hybrid Analysis of protein-protein interaction: Patch transformants onto master –leu, -trp plates (selects only for the plasmids, not reporter gene activation) and subsequent Y2H interaction analysis. Note how “red” the colonies are compared to that of other students. Measuring nucleic acid abundance by real time PCR 11. Analysis of the real time PCR results to measure the concentration of an unknown sample of DNA Validate mRNA deep sequencing results indicating novel splicing events– create cDNA library of yeast mRNA Use cDNA library as DNA template for analysis of YMR147W (new intron) and IWR1 (3' alternative splice site) TODAY 14. RNA interference in C. elegans – part I, prepare feeder plates Preparation of ss-pTZ18u/19u – review recovery Nitrous acid mutagenesis of lacZ – convert chemically treated ssDNA into dsDNA Use of 5FOA in plasmid shuffle to score gene function – test hypothesis that FOA+ colonies are ura- score results Inspect rtPCR products resolved on a 5% polyacrylamide gel to score for novel splicing events Illumina DNA sequencing Quiz

* Christen’s Gel Lane 1: Uncut ds pTZ18u Lane 2: ss pTZ18u DNA
Lane 4: ss18u + ss19u Lane 5: 1kb ladder * Group 1 Gel Lane 1: 1kb ladder Lane 2: Uncut ds pTZ18u Lane 3: ss pTZ18u DNA Lane 4: ss pTZ19u DNA Lane 5: ss18u + ss19u

Test the prediction that the FOA+ (resistant) colonies are ura- (minus)
- ura – leu plate FOA+ YCplac111 LEU2, SPP382 FOA+ YCplac111 LEU2, spp382-SQS1 URA3-SPP382(N19), YCplac111 LEU2 –SPP382 URA3-SPP382(N19), YCplac111 LEU2, spp382-SQS1

Use of RNA interference (RNAi) to investigate gene function in Caenorhabditis elegans (C. elegans).
Basic principle: One specific dsRNA (your choice) is expressed in E. coli. One strand of this dsRNA is complementary to a natural C. elegans cellular RNA The C. elegans eat this bacteria, releasing the dsRNA into the animal – the dsRNA is then taken up by the tissues of C. elegans. The dsRNA is processed within the C. elegans cells by DICER, loaded onto the RISC complex which targets the natural complementary cellular RNA of C. elegans for destruction. As the mRNA is degraded, no new protein corresponding protein is made – in essence, removing one specific gene product from the animal. The animal’s phenotype is a consequence of growth & development in the absence of this protein. From such experiments, you can characterize novel gene function, identify new biochemical/developmental pathways (i.e., learn what a gene does and why it is important to the animal). The RNAi pathway is natural & found in most eukaryotes. Consequently, RNAi “knockdowns” can be conducted in almost any organism for which some genetic information is available. C. elegans is especially convenient to use as the RNAi can be “fed” and the RNAi response is passed on through the generations (so, the offspring of adults exposed to the dsRNA will also show the phenotype).

As an adult, C. elegans consists of 959 somatic cells plus about 2000 germ cells in the hermaphrodite; exactly 1031 somatic cells plus about 1000 germ cells in the male) Caenorhabditis elegans (C. elegans) is a small, free-living soil nematode (roundworm) that lives in many parts of the world. It survives by feeding on microbes, primarily bacteria Most animals are self fertilizing hermaphrodites though a low population of males are present in each population – the males are smaller & with a flat “tail”.

~2.3 days from egg to reproducing adult

NL2099 rrf-3(pk1426) This strain has a homozygous rrf-3 deletion of a gene, RRF-3, which antagonizes (inhibits) the somatic RNAi response. Consequently, the rrf-3 deletion mutant has a very strong (hypersensitive) RNAi response and is generally used in RNAi experiments. KH1125: Asd1-1, ybIs733[myo-3::EGL-15BGAR::GFP + lin-15(+)]. GFP/RFP chimeric expression of EGL-15BGAR reporter in body wall muscles. We will use this strain to score the sup-12 RNAi construct to see if loss of this particular RNA splicing factor alters the muscle-specific splicing of a GFP/RFP reporter construct present in the genome of the KH1125 worms.

Caenorhabditis elegans (Nature Methods, 2006) KH1125 reporter strain
Use of an alternative splicing reporter with RNAi to characterize the function of specific splice site regulators. The reporter transcripts can be spliced to either produce GFP (green exon inclusion) or RFP (purple exon inclusion). The splicing event used depends on the tissue where the gene is expressed. There are many splicing regulators & these are mRNA-specific. RNAi knockdown of certain splicing regulators may alter the RNA processing of our GFP/RFP reporter transcript. Is sup-12 one of these?

TODAY – we spread 6 NGM –Amp plates with 5 bacterial cultures
HT115-L4440: This is the bacterial host strain that is transformed with the empty vector plasmid used to produce in E. coli double stranded RNA for: L4440 (empty vector) – produces dsRNA from vector-derived sequence that is not complementary to any natural C. elegans gene/transcript. Use for C. elegans strains rrf-3 and KH Two plates today. L4440 (CLF1): Crooked neck-like factor 1 encodes an essential 744 amino acid protein that is a required subunit of the spliceosome (the mRNA splicing enzyme). The RNAi animals die during embryonic development. Use rrf-3 C. elegans (one plate) L4440 (Dpy-1): DumPY -1 encodes a 1286 amino acid protein important for normal fat metabolism. The dpy-1 knockdowns are shorter and stouter than wildtype and also show lower levels of lipid. Use rrf-3 C. elegans (one plate) L4440 (Unc-22): Uncoordinated 22 encodes twitchin, a giant (6049 amino acid) intracellular protein required in muscle for regulation of the contraction-relaxation cycle. RNAi knockdown animals move slowly and show trembling and may appear to clump together when compared to wild type worms. Use rrf-3 C. elegans (one plate). L4440 sup-12 encodes an RNA-binding protein that functions as a muscle-specific splicing factor to regulate alternative pre-mRNA processing of unc-60 and egl-15 transcripts. J Cell Biol, 167, J. Cell Biol. 167: (2004). For this strain only, e use an egl1-15 based dual reporter C. elegans strain called KH1125 that can be alternatively spliced to produce a GFP (which fluoresces green) or RFP (which fluoresces red) fusion protein. This gene is expressed mostly in muscle and is most obvious in the larval and adult pharynx. (one plate ).

Spin out 1.5 ml of the five E. coli cultures (with the L4440 empty vector control twice – for a total of 6 tubes) in the microfuge. Resuspend the cell pellet in 300 μl of fresh broth containing 1 mM IPTG Incubate at room temperature for 20 minutes. IPTG induces the lac promoter which drives expression of the T7 RNA polymerase gene needed to transcribe the C. elegans genes present in the L4440 vector. Next, pipet the cells onto plates NGM with 100 μg/ml ampicillin that were previously spread with 50 µl of fresh 100 mM IPTG. Swirl to roughly spread the culture and incubate at 37C.

Deamination: Nitrous Acid as a mutagen
Nitrous acid (HNO2), which acts as a mutagen by deamination of the NH2 group of adenine and/or cytosine to an ether group, thus altering their base pairing. After replication, the chemically altered bases are replaced by the mutated residue (G/*C ->A/T or A*/T-G/C). ( ). Single-stranded DNA is much more sensitive to nitrous acid mutagenesis than double stranded DNA. Hence, we will use non-recombinant pTZ18u, our original cloning vector, prepared as single-stranded DNA as you did in class.

Random chemical mutagenesis of DNA, part II
Random chemical mutagenesis of DNA, part II. The pTZ18u DNA was mutagenized, precipitated, dried and resuspended in 10 µl of sterile water. Today we will begin a test the prediction that the number of ampicillin resistant, lacZ defective pTZ18u E. coli transformants will increase with plasmid mutagenesis. First we will convert the mutagenized ssDNA into mutagenized dsDNA which transforms E. coli much more efficiently. Add your 10 µl of mutated DNA to 14 µl of the following mix in a PCR tube 10.25 µl of sterile water 0.5 µl of complementary oligonucleotide primer* (0.5 µg of the reverse primer used for our inverse PCR experiment) 2.5 µl of NEB Taq 10X reaction buffer 0.75 µl of 10 mM dNTP Add 1.0 µl of NEB Taq polymerase (~5 units) – mix briefly, spin briefly (put in a regular microfuge tube with the cap cut off, spin at 2,000 rpm only Polymerization (only one cycle used, this is not PCR, simply second strand synthesis): 94C 3 minutes 45C 5 minutes 65C 10 minutes Transfer the completed PCR reactions into fresh 1.5 ml tubes. Label the cap of the tube either “5” or “20” depending on the mutagenesis time. Label the side of the tube with your group number, your initials and today’s date (11/12/14). Put these tubes in the rack at the front of the lab.

Illumina Sequencing Massively parallel fully automated DNA and RNA sequencing – rapid generation of 5-25 gbp in 3 to 10 days. Analysis requires extensive computational reconstruction (mapping short reads of 75 to 300 bp back to the genome) Sequencing new genomes and learning what the mRNA compositions are in different tissues, developmental stages, disease states etc. HiSeq; MiSeq

Illumina Isothermal bridge amplification
Illumina Isothermal bridge amplification. Template DNA fragments (green and pink) are ligated to oligonucleotide adaptor sequences (orange and red), denatured to form single stranded DNA, and allowed to hybridize to complementary capture oligonucleotides covalently linked to the surface of the flow cell. Using the capture oligonucleotides as a primer, the templates are copied, and then denatured once again. The newly synthesized DNA molecules can then bend to hybridize with an adjacent capture oligonucleotide primer, which serves as the next primer for DNA synthesis. This process is repeated until clusters of clonal copies of an identical template are generated on the surface of the flow cell. Matthew W. Anderson and Iris Schrijver ,Next Generation DNA Sequencing and the Future of Genomic Medicine Genes 2010, 1, 38-69;

Matthew W. Anderson and Iris Schrijver ,Next Generation DNA Sequencing and the Future of Genomic Medicine Genes 2010, 1, 38-69 Illumina sequencing chemistry. A sequencing primer (red) is annealed to the template molecules linked to the flow cell surface. Next, DNA polymerase and a mixture of fluorescently labeled nucleotides are added to the flow cell. The nucleotides are modified with a cleavable terminator moiety such that only one nucleotide can be incorporated during each sequencing cycle. After nucleotide incorporation, the fluorescent signals are recorded for each cluster. Finally, the terminator moiety and fluorescent label are chemically cleaved off and removed, and fresh nucleotides and polymerase are added to begin the next sequencing cycle.

Chrom: Yeast chromosome where the gene is located
Start/end: beginning and end of the intron ORF: Open reading frame designation (unique identifier for yeast genes; YBL093 = Yeast; 2nd chromosome; Left of the centromere; 93 ORF from the centromere) Gene: common name of gene Exp: relative expression level (Low, Medium, High) Alt. site: alternate 5’ splice site, 3’ splice site or both Flank: 2 nucleotides of exon sequence before and after intron In SGD? Was this annotated in the Saccharomyces cerevisiae genome database at the time of the experiment? Ares 4.1: Was this annotated in the Dr. Manny Ares database at the time of the experiment? WT depth: Number of times the sequence occurs in the wildtype yeast H218A depth: Number of times the sequence occurs in the prp43H218A mutant yeast We will score for the new intron in YMR147W and for the alternative 3’ splice site in IWR1

1. Identify gene variants. Isolate genomic DNA from haploid yeast strains with 1) a wildtype SQS1 gene 2) a sqs1::KAN gene disruption and from a diploid strain with both at SQS1 and sqs1::KAN allele. Use the polymerase chair reaction (PCR) to amplify the genomic DNA from a haploid WT yeast (SQS1), a haploid sqs1::KAN mutant and heterozygous diploid made by mating each haploid parent SQS1/ sqs1::KAN. The predicted size PCR fragments are 2963 bp (SQS1) and 2243 bp (sqs1::KAN) which will be used to determine which of the coded yeast strains contain the wildtype and mutant SQS1 alleles. Inverse PCR to generate a site-specific deletion (mutation) of plasmid pTZ18u. We will remove the 307 bp F1 origin of ssDNA replication. Consequently, the inverse PCR product will produce a DNA fragment of 2553 while the orignal vector is 2860 bp. Discussion of Yeast Two-Hybrid (Y2H) Experiment 5. Agarose gel electrophoresis of your 1) coded yeast genomic DNA preparations and 2) deletion mutant of recombinant-pTZ18u created by inverse PCR 6. Yeast Two-Hybrid Experiment – transformation of the PJ69-4A (pAS2-PRP43) host with 10 derivatives of the PXR1 gene as GAL4 (activation domain) protein fusions on plasmid pACT2. 7. Analysis of the prp38-1 genetic complementation experiment by wildtype PRP38 introduced by yeast transformation in strain ts192. Questions related to Wednesday’s exam 8. Affinity purification of a recombinant protein: IPTG induction of the SPP382(codons 1-121)-intein-chitin binding domain gene on plasmid pTZB1 9. Yeast Two-Hybrid Analysis of protein-protein interaction: Patch transformants onto master –leu, -trp plates (selects only for the plasmids, not reporter gene activation) and subsequent Y2H interaction analysis. Note how “red” the colonies are compared to that of other students. Measuring nucleic acid abundance by real time PCR 11. Analysis of the real time PCR results to measure the concentration of an unknown sample of DNA Validate mRNA deep sequencing results indicating novel splicing events– create cDNA library of yeast mRNA Use cDNA library as DNA template for analysis of YMR147W (new intron) and IWR1 (3' alternative splice site) TODAY 14. RNA interference in C. elegans – part I, prepare feeded plates Preparation of ss-pTZ18u/19u – review recovery Nitrous acid mutagenesis of lacZ – convert chemically treated ssDNA into dsDNA Use of 5FOA in plasmid shuffle to score gene function – test hypothesis that FOA+ colonies are ura- Inspect rtPCR products resolved on a 5% polyacrylamide gel to score for novel splicing events Quiz

Nitrous acid mutagenesis of lacZ – part II, convert chemically treated ssDNA into dsDNA; III, transform TG1 and select on LB-amp + IPTG/X-gal RNA interference in C. elegans – part I, prepare feeder plates; II, add nematode worms

10/31/18 BIO 510 provides the conceptual and experimental framework needed to address current questions in molecular biology. This course evolves address technological developments and in response to student interest. Here we seek your input on priorities for new experimental approaches to cover in subsequent years. Expanded Homework (20 points): Design an experiment for next year’s class that asks whether a particular gene is sensitive to epigenetic regulation. For ideas, think about the kits in the NEB catalog (starting on page 271) In general a good job, but lots of gaps. I made comments on your homework and you have until Monday November 26 to return both the original and the revised copy for grading. Your grade will be based wholly on the revised version.

Random Chemical Mutagenesis of pTZ18u : E. coli Transformation
‑Mix 500 μl of competent E. coli with 5 μl of your mutagenized DNA. You do two transformations, one with the T= 5 min and the other with the T=20 min mutagenesis. The TAs will do the unmutagenized control pTZ18U. ‑Incubate the cell/DNA mixture on ice for 30 min. ‑Transfer the tube to the 42oC water bath for 1 minute (timing is important during this step). Be sure that the water bath is correctly set at 42oC before incubating your cultures since 42C is close to the upper limit for E. coli cell viability. ‑Add 2 ml of 2XYT broth. Incubate at 37oC with vigorous shaking for 45 min ‑After the 45 min incubation, plate 50 of each of the NA-treated samples on LB-amp plates containing 30 μl of 100 mM IPTG and 70 μl 20 mg/ml X-gal. -Christen will plate 50 μl of the unmutagenized control samples on LB-amp/IPTG/X-Gal plates. Incubate all plates inverted overnight at 37C. CRITICAL: Spread the IPTG/X-gal and the cells evenly over the entire surface of the plate. Spread the IPTG/X-gal and cells immediately after pipetting –do not allow these to dry on the plate

1. (2 pts) Treatment of single-stranded DNA with nitrous acid causes _deamination (name chemical reaction) of cytosine residues resulting in the formation of __uracil__(name base cytosine is converted to). DNA replication through the modified region results in G:C to A:T____ (name base pair) changes which are called (transition, translation, transversion, neutral [circle correct response]) mutations. 2. (2 pt) The presence of 5-FOA in the growth medium (increases the rate of URA3 mutagenesis; blocks URA3 mutagenesis; selects for URA3 wildtype yeast; causes plasmid loss; none of the above [circle correct response]). The toxic byproduct of 5-FOA metabolism is 5-fluorouracil__ (name compound). 3. (3 pts) You have a defined set of 245 genes known to be involved in toxic metal resistance in wheat. You have identified a new wheat variety that is no longer sensitive to cadmium exposure (for instance, the standard wheat is killed by cadmium but the new variety survives this exposure). Design an experiment using Nanostring technology to determine if these is any difference in the expression profiles of the wildtype and cadmium resistance strains after cadmium exposure (that is, you are comparing the profiles of the two strains after cadmium is added to both). You answer must contain a description of the Nanostring technology principles & use. Isolate RNA from both stains before and after exposure to cadmium. Incubate the RNA with the capture (biotin substituted) and readout (florescent code) oligonucleotides corresponding to the 245 genes. Bind to the streptavidin slide, wash out non- incorporated oligos. The Nanostring machine then aligns the readout oligos using an electric field and identifies how often each mRNA is found in the two samples. The difference in expression patterns can then be deduced by comparing the +/- Cd response between strains. (3) You have a pair of PCR primers that bind exon sequences flanking the intron of the ACT1 mRNA containing gene. You isolate yeast nucleic acid using the glass-bead breaking method used in class and perform a reverse-transcriptase PCR experiment to measure the relative PCR signals resulting from the 400 nt spliced mRNA and the 800 nt unspliced (intron bearing) ACT1 pre-mRNA. Your bench mate does the same experiment but leaves out the DNase treatment step of the yeast mRNA. You resolve your PCR products and your bench mate’s PCR products side-by-side on a gel. Draw a gel image that show the expected results (label the lanes and bands). Describe why your bench mate’s PCR products look different compared to yours. Simply put, the benchmate’s PCR will show much more of the 800 bp PCR product since genomic DNA gives the same PCR band as unspliced pre-mRNA. Also, the bench mate (but not your) experiment would show the 800 bp band in the “no reverse transcriptase” control.

*

Pipet the worms anywhere on the plate – on the bacteria is fine.
Use of RNA interference (RNAi) to investigate gene function in Caenorhabditis elegans (C. elegans). 1) Plate RNAi feeder strains of E. coli on NGM medium Today 2) Apply KH1125 and NL0299 L1 larvae to the agar plates with RNAi feeder strains. Use 200 µl of worms per plate. IMPORTANT: The worms sink to the bottom of the tube, mix the tube by inversion before every pipetting. To avoid damaging the worms, pipet using the P-1000 and the blue tips KH1125 Plates HT115-L4440 empty vector control Sup-12 alternative splicing factor NL2099 (rrf-3) Plates Unc-22: Uncoordinated 22 Dpy-1: DumPY -1 CLF1: Crooked neck-like factor 1 Pipet the worms anywhere on the plate – on the bacteria is fine.

1. Nitrous acid mutagenesis of lacZ – part II, convert chemically treated ssDNA into dsDNA; III, transform TG1 and select on LB-amp + IPTG/X-gal; score the % white/ampR colonies before and after mutagenesis 2. RNA interference in C. elegans – part I, prepare feeder plates; II, add nematode worms, III observations – work size, shape, mobility, numbers 3. Use of TAP-epitope tagged yeast strains to compare relative protein abundance, part I, protein preparation 4. Genome editing with CRISPR-Cas9, part I transform Cas9-containing yeast with the guide RNA expressing plasmid or an empty vector control

In our experiment, the target gene is
CRISPR-Cas9 – an efficient means of engineering genomes In our experiment, the target gene is CAN1 When CAN1 is functional, the amino acid canavanine kills the cells If CAN1 is mutated by CRISPR-Cas9 cleavage, the cells are resistant to canavanine Cas9 is an endonuclease that makes dsDNA cuts at genomic DNA sequences. The guide RNA is the specificity factor - it base pairs with the genomic DNA site to be cut and also binds the Cas9 endonuclease. Cleavage happens here.

Today we will transform yeast strain CL11-7 which as a galactose inducible Cas9 double stranded DNA endonuclease gene (GAL-Cas9::LEU2) integrated into its genome. CL11-7 Genotype: GAL-Cas9::LEU2 (Mat A: ura3Δ851 trp1Δ.63 leu2Δ::Kan plus a few other markers) This yeast will be transformed with two different plasmids, one by each member of a lab team. One plasmid is an empty vector, pRS426, which contains a yeast replication origin and the URA3 gene (for complementation of the host ura3Δ851 mutation but does not express a guide RNA. The second plasmid, pRS426- SNR-gRNA.CAN1.Y is equivalent but constitutively expresses the CAN1 guide RNA from the SNR52 small nucleolar RNA gene promoter. Mutations introduced into CAN1 by Cas9 result in resistance to canavanine See the following paper for a full description of this system. DiCarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Research. 2013;41(7): doi: /nar/gkt135.

CAN1 encodes an arginine permease gene and its expression permits the cell to import the toxic amino acid, L-canavanine found naturally in plants (alfalfa sprouts, fava beans, jack beans). L-canavanine can be incorporated instead of arginine in growing protein chains but, due to its different structure, produces non-functional proteins – resulting in cell death. When Cas9 is expressed together with the CAN1 guide RNA, the CAN1 gene cut by the endonuclease – the error prone DNA repair of this dsDNA cut gives rise to lots of local mutations that destroy CAN1 function. Since can1 mutants cannot import L-canavanine, these are resistant to the toxic effects of this drug.

Already done for you Start off with ~30 ml of a mid to late log culture of yeast (OD 600 between 2 and 4) grown in YPD medium. Wash the culture twice with 5 ml of Li buffer (100 mM LiOAc, 10 mM Tris pH 7.5, 1 mM EDTA). Spin as before and then resuspend in 2 ml of Li buffer.

4. START HERE: Add 500 µl of the CL11-7 culture to each 13X100 mm (small) capped glass culture tube. Prepare and label one tube for each DNA to be tested. Be sure to note the specific construct used. 5. Add plasmid DNA (1-3 µg in 10µl), incubate for 5 minutes at room temperature. Student #1 should use pRS426 and student #2 use pRS426-SNR-gRNA.CAN1.Y. 6. Add 25 µl of 10 mg/ml salmon sperm DNA (heat denatured for 10 then quick chilled on ice prior to use). NOTE: Get the denaturation started during the yeast wash steps (#2, above), since it takes some time to complete. 7. Add 25 µl of DMSO incubate 10 minutes at room temperature. 8. Add 2.5 ml of 40% PEG 3000 in Li buffer. Incubate for 30 minutes at 30C. 9. Heat shock at 42C for 15 minutes. 10. Spin out the culture, wash once in 1 ml of sterile (i.e., freshly autoclaved) water. You can vortex to mix the cells. Spin the cells for 5 minutes at full speed in the clinical (tabletop) centrifuge. Pour off the liquid. Vortex what is left in the tube (usually ~ 150 µl of liquid remains) and plate the yeast evenly on –uracil glucose plates. This medium selects for the plasmid and inhibits transcription of all galactose-inducible genes (including GAL-Cas9). Incubate plates at 30C.

RNAi expression

TODAY – we spread 6 NGM –Amp plates with 5 bacterial cultures
HT115-L4440: This is the bacterial host strain that is transformed with the empty vector plasmid used to produce in E. coli double stranded RNA for: L4440 (empty vector) – produces dsRNA from vector-derived sequence that is not complementary to any natural C. elegans gene/transcript. Use for C. elegans strains rrf-3 and KH Two plates today. L4440 (CLF1): Crooked neck-like factor 1 encodes an essential 744 amino acid protein that is a required subunit of the spliceosome (the mRNA splicing enzyme). The RNAi animals die during embryonic development. Use rrf-3 C. elegans (one plate) L4440 (Dpy-1): DumPY -1 encodes a 1286 amino acid protein important for normal fat metabolism. The dpy-1 knockdowns are shorter and stouter than wildtype and also show lower levels of lipid. Use rrf-3 C. elegans (one plate) L4440 (Unc-22): Uncoordinated 22 encodes twitchin, a giant (6049 amino acid) intracellular protein required in muscle for regulation of the contraction-relaxation cycle. RNAi knockdown animals move slowly and show trembling and may appear to clump together when compared to wild type worms. Use rrf-3 C. elegans (one plate). L4440 sup-12 encodes an RNA-binding protein that functions as a muscle-specific splicing factor to regulate alternative pre-mRNA processing of unc-60 and egl-15 transcripts. J Cell Biol, 167, J. Cell Biol. 167: (2004). For this strain only, e use an egl1-15 based dual reporter C. elegans strain called KH1125 that can be alternatively spliced to produce a GFP (which fluoresces green) or RFP (which fluoresces red) fusion protein. This gene is expressed mostly in muscle and is most obvious in the larval and adult pharynx. (one plate ).

Caenorhabditis elegans RNAi knockdown, part III
Caenorhabditis elegans RNAi knockdown, part III. Under the dissecting microscope, compare the 1. sizes, 2. shapes, 3. numbers and 4. movement of the RNAi knockdown animals with the empty vector control worms with that of those containing an RNAi selected to destroy a cellular mRNA. Record each of these characteristics in your notebook – clearly describing the observed RNAi defects. We will view the worms again next Monday We will also be using a florescence microscope on the 3rd floor to monitor changes in alternative pre-mRNA splicing (discussed in class).

Chemical Mutagenesis of pTZ18u with Nitrous Acid
Nitrous acid treatment of naked single-stranded DNA & DNA cleanup Conversion of NA-treaded ssDNA into dsDNA using primed DNA synthesis Transformation of TG1 E. coli with mutagenized dsDNA TODAY 4. Determine the % blue and white colonies on the IPTG/X-gal plates for the 5 minute and 20 minute timepoints. The TA will provide the values for the control plates. Note – with extended incubation, white colonies sometimes develop a small blue center spot compared with the blue colonies which are uniformly blue – count these as “white”. Before we report the blue/white totals, I will speak to each group about their particular plates. Students with very low levels of colonies will “re-plate” there transformations with 100 µl of culture (rather than the 20 µl we used before)

Global epitope tagging studies on virtually all yeast protein-coding genes (~6,500) have been completed. These have been used to determine: The relative cellular abundance of each protein within a cell (using GFP or TAP protein fusion tags). Changes in relative abundance during altered growth. Turnover rate of proteins within the cell. Sub-cellular locations of each protein under a variety of conditions (e.g., growing or quiescent, activation of specific signal transduction pathways, cell cycle dependence). The composition of protein complexes (TAP tag; select protein and use mass spectrometry to find associated partners).

TAP-tagged Proteins ProtA = protein A, binds IgG molecules
CBP = calmodulin binding domain (binds calmodulin agarose) TEV – tobacco etch virus protease cleavage site

Protein preparation (groups 1-4). Each student does TWO samples
Change – today we will do protein preparation only (gel on Monday) 1. Write the name of the TAP-tagged (or control culture) on a microfuge tube. Spin 1.5 ml of your assigned yeast culture for 1 minute in the microfuge at full speed. Discard the supernatant and resuspend the pellet in 500 µl of 2M lithium acetate. Incubate for 5 minutes at room temperature. 2. Spin out the culture (1 minute in the microfuge at full speed). Discard ALL of the supernatant and resuspend the pellet in 500 µl of 0.4M NaOH. Incubate for 5 minutes at room temperature. 3. Spin out the culture (1 minute in the microfuge at full speed). Discard ALL of the supernatant and resuspend the culture in 400 µl of protein loading buffer containing 7M urea. 4. Heat the sample in a locked tube at 100C for 5 minutes. – >dry ice (stop)

Chemical Mutagenesis of pTZ18u with Nitrous Acid
Nitrous acid treatment of naked single-stranded DNA & DNA cleanup Conversion of NA-treaded ssDNA into dsDNA using primed DNA synthesis Transformation of TG1 E. coli with mutagenized dsDNA TODAY 4. Use of the TAP-tag to compare relative protein abundance – run 7.5% acrylamide gel, set up membrane transfer, block membrane with 5% non-fat dry milk. 5. Final inspection of C. elegans knockdown animals. Record (relative to L4440 controls) 6. Finalize the % blue and white colonies on the IPTG/X-gal plates for the 5 minute and 20 minute time points. The TA will provide the values for the control plates. 7. CRISPR-Cas9 mutagenesis – patch empty vector and CAN1 gRNA expressing plasmid on –ura galactose medium to induce Gal-Cas9 gene expression

NEXT WEEK - Combining Genetics with Molecular Biology to Define Genes in a Biological Pathway: Identification of pre-mRNA splicing factors Read each of these assigned papers (all on Canvas under “Reading Assignments”) Order of presentation – please have the first two read by Monday Forward genetics – ts mutant screen (Prp38, Prp39) Dosage suppression (Spp381) Extragenic suppression & proteomics (Spp382, also guilt by association, Cwc23) Bioinformatics: Guilt by sequence similarity (Smd1, Prp42, Clf1) Synthetic lethality (Bud13, Cet1, Cwc2, and Rds3) Next Friday – visit to the Mass Spectrometry facility (Dr. Bert Lynn)

5. Heat your protein at 100C for 5 minutes then load the gel with 15 μl of sample on a 7.5% polyacrylamide gels (29:1 acrylamide: bisacrylamide) in the following order NEB Pre-stained Broad Range Protein Molecular Weight Markers ul Sup35-TAP Tda1-TAP Pgk1-TAP BY4743 no TAP (repeat loading as needed for all student samples). IN YOUR NOTEBOOK – add the predicted molecular weight for each protein - use SGD to find this information. NOTE: The TAP tag adds approximately 20 kDa more mass to each protein. 6. Run the gel with 650 ml of running buffer at 100V for 10 minutes then at 150 volts for 50 minutes. While the gel is running, soak the Immobilon P (polyvinylidene fluoride; PVDF) hydrophobic membrane in 100 ml of: 100% methanol (5 minutes), distilled water (5 minutes), protein transfer buffer (15 minutes). Be absolutely certain that the membrane stays under the liquid at all times. If it dries out, the proteins will not transfer. 7. At the end of the 1 hour run, remove the gel to a vat of transfer buffer. Assemble the transfer "sandwich" from top to bottom (scotchbrite pad, filter paper, gel, membrane, filter paper, scotchbrite pad). Transfer at 150 volts for one hour in 1L of transfer buffer. 8. Remove the gel, place the filter "protein side up" in a staining tray. Remove the markers by cutting off the strip. Briefly stain the membrane with Ponceau S to image & record (photograph) total protein transfer 9. Incubate the membrane in the blocking agent (i.e., 5% nonfat dry milk in phosphate buffered saline -PBS-milk) for 15 minutes. Pour off the milk and incubate the membrane overnight (with shaking) in PBS-milk containing a 1:2000 dilution of anti-peroxidase antibody conjugated to the enzyme horse radish peroxidase (PAP).

Yeast Consensus Sequences
5’ splice site: GUAUGU Branchpoint: UACUAAC 3’ Splice site: PyAG YMR147W AUGGCAGCCAGGAAUCGUAGAAAGAAUAACAAGAAAAAGUCCCUUUUGGUAACGAGUGCCGCUCAAGAAAAGAAUGCGACGUAUGUGCUCGUUGCAGAGGAAUUACAUAAAAAAACAAUCGAUCUAAACAUGGGUACUGAAACACCUUUAACGGAAAACCACGAGAAUCCUAUACCAGCGAAAGAAUUCAAGCACCAGCAAAAAUUAGAGCCAAUAGACGAACAUGAUGAUGGCGAAGACGAAUUAUCGAUAAAAUUUAAGUCCAUGACAAAAAGCUCGGGGCCUAUUACUGAGGCUGAAGUUCAAAAGCUGCUCCUAAGCUAUGCCUUCACAAGUGCUGCAAUACAGGAGGACGAAAACGAGAAAGAAUCGCGUCACUAUCCUAUUAAACCGCCUUCGCCAUCAGCUUCUUCUUUGUCCGCCUAUUUUCAAUCCUUCGUUGAAAAAUGCAAACAGGUUUUCUACAACUUCAGUCUGCAAACAGUAGAAAAAUUAAAUGCUCUACAAAAUAGCUUGUACGAAGUAUUUUGGAUUAUUUUUAUUUAUUUAAACUACUGGUUCCCCAAUGUGGGUGACUAUGUGAGGUAUGUCUGUCGUAGCUUCUCGCGCCAUAACGAAAUUGCCCAAUUACUAACACGUAUUUUUACUUACAAUAUCAACCACCUCCACUAAUGAACAGGCACAGUAUAGAAAAAAA

3. Your lab head proposes that that the low-level splicing of the YMR147W intron is essential for cell survival. Design an experiment to definitively test this hypothesis whether or not the minor spliced product is essential (for the purposes of this exercise assume that the major unspliced product of YMR147W is essential and that changing even one amino acid of the unspliced product is lethal). Set up a plasmid shuffle experiment in which a URA3-marked plasmid carries a fully wildtype version of the YMR147W gene (produces spliced and unspliced) and another plasmid (marked, for instance with LUE2) carries the a mutant YMR147W that is unable to splice the mRNA. If FOA+ colonies are found, then the spliced mRNA cannot be essential for cell survival. The mutation introduced needs to be a base change that 1) blocks splicing and 2) does not change the protein coding capacity of the unspliced mRNA (for instance if GUAUGU formed codons GUAUGU (valine-cysteine) then GUUUGA will inhibit splicing but still code for valine-cysteine (that is, GUA and GUU are both valine codons. Note: you also need to note the host genotype as: YMR147w::KAN (or another null mutations), leu2, ura3 for this experiment to work

5. Final inspection of C. elegans knockdown results
5. Final inspection of C. elegans knockdown results. Record (relative to L4440 controls): a. relative numbers of animals b. sizes of animals (are multiple larval forms present? Unhatched eggs/embryos? c. shapes of animals (long and slender? short an stout?) c. movement of animals (smooth even sliding? Lots of “back & forth” movement? Animals that appear to be paralyzed or stuck together? Do your observations match the predictions in your lab manual?

Group - time # blue + white # white
1 – 5 minutes 1- 20 minutes 2 – 5 minutes 2- 20 minutes 3 – 5 minutes 3- 20 minutes 4 – 5 minutes 4- 20 minutes NEG CONTROL 5 minutes 20 minutes

Caenorhabditis elegans (Nature Methods, 2006) KH1125 reporter strain.
Use of an alternative splicing reporter with RNAi to characterize the function of specific splice site regulators. The reporter transcripts can be spliced to either produce GFP (green exon inclusion) or RFP (purple exon inclusion) due to E5A or E5B exon inclusion. The splicing event used depends on the tissue where the gene is expressed. There are many splicing regulators & these are mRNA-specific. RNAi knockdown of certain splicing regulators may alter the RNA processing of our GFP/RFP reporter transcript. Is sup-12 one of these?

GFP RFP GFP + RFP L4440 COntrol Image 1: GFP Image 2: GRF
Image 3: Merged CW KH Sup12 Image 1: GFP Image 2: GRF Image 3: Merged

SUP-12 present SUP-12 knockdown
GFP RFP SUP-12 present SUP-12 knockdown

SUP-12 knockdown blocks the E4-5A splicing event favoring inclusion of the GFP exon (E4-5B)

CRISPR-Cas9 – an efficient means of engineering genomes
In our experiment, the guide RNA expressed from plasmid pRS426-SNR-gRNA.CAN1.Y. targets the CAN1 gene of yeast. CAN1 CL11-7 Genotype: GAL-Cas9::LEU2 (Mat A: ura3Δ851 trp1Δ.63 leu2Δ::Kan plus a few other markers) Transformed empty vector, pRS426, which contains a yeast replication origin and the URA3 gene (for complementation of the host ura3Δ851 mutation but does not express a guide RNA. The and with pRS426- SNR-gRNA.CAN1.Y is equivalent but constitutively expresses the CAN1 guide RNA from the SNR52 small nucleolar RNA gene promoter. Mutations introduced into CAN1 by Cas9 result in resistance to canavanine.

CRISPR-Cas9 Directed Mutagenesis of the CAN1 gene, part II
CRISPR-Cas9 Directed Mutagenesis of the CAN1 gene, part II. Today we will patch the pRS426 control and pRS426-SNR-gRNA.CAN1.Y targeting gene transformants from the glucose medium to galactose medium. Since yeast strain CL11-7 has a galactose-inducible Cas9 gene integrated into its genome this transfer will induce Cas9 expression and where the targeting plasmid is present, stimulate RNA synthesis that directs CAN1 cleavage (and inactivation). Using the wide end of toothpick and the grid provided, patch a colony to -uracil + galactose yeast medium. Each student should patch 14 colonies (either pRS426 or pRS426-SNR-gRNA.CAN1.Y) in rows (3:4:4:3) on the -ura galactose plate. This medium selects for the plasmid and promotes transcription of all galactose-inducible genes (including GAL-Cas9) BE SURE to leave empty space between the patches, do not cross-contaminate your colony purified cultures.

Use of TAP-tag to detect protein and monitor relative protein abundance
In a typical western blot, the protein transferred to the membrane is incubated with a primary antibody that is specific for the protein of interest. For example, you might use an antibody raised in rabbits against the yeast actin protein (mouse anti-yeast actin primary). After removing unbound primary antibody, a secondary antibody raised in a different organism and directed against the constant region of the primary antibody (not the protein of interest) is added. This secondary antibody is either directly florescent or is covalently joined (conjugated) to an enzyme for which an assay exists to allow detection (for example, goat anti-mouse IgG-horse radish peroxidase [HRP]). Light emitted from the HRP chemistry (chemiluminescence) can be captured on X-ray film or a light sensitive imaging system (in essence, a sensitive camera). We will use detection of alkaline phosphatase with a chromogenic substrate (one that changes color with enzyme action. Primary Secondary Development/detection

6. Run the gel with 650 ml of running buffer at 100V for 10 minutes then at 150 volts for 50 minutes. While the gel is running, soak the Immobilon P (polyvinylidene fluoride; PVDF) hydrophobic membrane in 100 ml of: 100% methanol (5 minutes), distilled water (5 minutes), protein transfer buffer (15 minutes). Be absolutely certain that the membrane stays under the liquid at all times. If it dries out, the proteins will not transfer. 7. At the end of the 1 hour run, remove the gel to a vat of transfer buffer. Assemble the transfer "sandwich" from top to bottom (scotchbrite pad, filter paper, gel, membrane, filter paper, scotchbrite pad). Transfer at 150 volts for one hour in 1L of transfer buffer. 8. Remove the gel, place the filter "protein side up" in a staining tray. Remove the markers by cutting off the strip. Briefly stain the membrane with Ponceau S to image & record (photograph) total protein transfer 9. Incubate the membrane in the blocking agent (i.e., 5% nonfat dry milk in phosphate buffered saline -PBS-milk) for 15 minutes. Pour off the milk and incubate the membrane overnight (with shaking) in PBS-milk containing a 1:2000 dilution of anti-peroxidase antibody conjugated to the enzyme horse radish peroxidase (PAP).

3. Use of TAP-epitope tagged yeast strains to compare relative protein abundance, protein preparation, PAGE separation of proteins and western transfer, blocking and PAP “primary” antibody incubation, wash off PAP, incubate with goat anti-rabbit-alkaline phosphatase antibody, develop blot with BCIP/NTB reagents 4. Genome editing with CRISPR-Cas9, transform Cas9-containing yeast with the CAN1 guide RNA expressing plasmid or an empty vector control, patch to –ura galactose plates to induce chromosomal GAL-Cas9 gene to stimulate CAN cleavage & mutagenesis, score experimental and control transformants on medium containing canavanine to learn if CAN1 gRNA directed Cas9 cleavage was effective

Last day for lab coats….

Ponceau S red stain of protein transfer
Group 1 & 2 Lane 1: Sup35-TAP Lane 2: Tda1-TAP Lane 3: Pgk1-TAP Lane 4: BY4743 Lane 5: Sup35-TAP Lane 6: Tda1-TAP Lane 7: Pgk1-TAP Lane 8: BY4743 What can we conclude? Equal recovery & transfer of proteins from each student – protein quality and quantity look fantastic For some reason the protein markers did not show – perhaps the marker was diluted too much or degraded Group 3 Lane 1: Sup35-TAP Lane 2: Tda1-TAP Lane 3: Pgk1-TAP Lane 4: BY4743

No problem, we will pencil in the makers on the figure distributed after AP development based on the relative positions from last year’s gels

Lab 23 Western Blot of an Epitope-tagged Protein (part II).
The membranes have been incubated in a solution of PBS-5% nonfat dry milk containing the rabbit anti-horse radish peroxidase antibody conjugated to the enzyme horse radish peroxidase (used at a 1:1500 stock dilution; NOTE: the class web site has the PDF describing this PAP antibody). This antibody will bind to the protein A sequence of the TAP epitope through the antibody constant region. The fact that the antibody is directed against horseradish peroxidase allows more than one antibody to be recruited to the TAP tagged protein (that is, one against the protein A segment and then others against the horse radish peroxidase covalently joined to the first antibody). This results in considerable enhancement of the signal. Wash the membrane 3 times 5 minutes each with 25 ml TBST buffer and a final time with PBS buffer (recipes on board). Be sure to remove all of the liquid during each wash but do not let your membrane dry. Add 25 ml of PBS-5% nonfat dry milk containing goat anti-rabbit alkaline phosphatase (1:1500 dilution). Incubate 1 hour with shaking.

Group - time # blue + white # white
1 – 5 minutes 1- 20 minutes 2 – 5 minutes 2- 20 minutes 3 – 5 minutes 3- 20 minutes Ave. Inactivating Mut. of LacZ 5 min 12/ % 20 min 19/ % NEG CONTROL 5 minutes Mut. <1/244 (<0.41%)* 20 minutes <1/301 (<0.33%)* *Previously measured rate of spontaneous lacZ mutations (white colonies) ~ 1/1000 = 0.1% so, the 20 minute nitrous acid mutagenesis raised the mutation rate 21-fold over the spontaneous mutation rate

CAN1 encodes an arginine permease gene and its expression permits the cell to import the toxic amino acid, L-canavanine found naturally in plants (alfalfa sprouts, fava beans, jack beans). L-canavanine can be incorporated instead of arginine in growing protein chains but, due to its different structure, produces non-functional proteins – resulting in cell death. When Cas9 is expressed together with the CAN1 guide RNA, the CAN1 gene cut by the endonuclease – the error prone DNA repair of this dsDNA cut gives rise to lots of local mutations that destroy CAN1 function. Since can1 mutants cannot import L-canavanine, these are resistant to the toxic effects of this drug.

CRISPR-Cas9 directed CAN1 gene disruption - part III
You now have patches of the CL11-7 strain transformed with either an empty vector plasmid (pRS426-URA3) or the CAN1 targeting plasmid (pRS426-SNR-gRNA.CAN1.Y; URA3) Since you’ve selected your transformants on galactose medium, the GAL-Cas9 is active in both sets of plates. However, only the pRS426-SNR-gRNA.CAN1.Y expresses the RNA targeting gene directly CAN disruption. You will now score your yeast transformants for the effectiveness of CAN disruption. Using the wide end of toothpick and the grid provided, patch a colony to yeast media in the following order: 1) minus uracil glucose (expect all to live since the yeast are coming from a minus uracil plate & each contains a URA3 marked plasmid that complements the chromosomal ura3 mutation of this yeast host strain) 2) minus adenine glucose plate (control for off-target mutagenesis; CL11-7 is able to produce its own adenine [it is an adenine prototroph], expect all to live UNLESS CRISP-Cas9 mutagenesis results in high generalized mutagenesis (that is mutagenesis outside of the CAN gene). Any ade- colonies would suggest off target hits genes associated with the 12 required enzymatic steps in de novo AMP biosynthesis)

Phosphoribosyl pyrophosphate (PRPP)
12 enzymatic steps in de novo AMP synthesis – loss of any of these activities results in an ade minus phenotype

Each student will also streak on
3) + 60µg/ml L-canavanine minus arginine glucose plates (expect yeast to die on this medium unless these is a mutation to CAN1 – if the experiment works properly, we anticipate a high rate of canavanine resistant colonies with the pRS426-SNR-gRNA.CAN1.Y transformant and few or none with the control, pRS426 empty vector transformant. To avoid confusion in our analysis patch to the canavanine plate last. 4) Repeat this for a total of 14 colonies – we will pool class data for analysis

Pour off the goat-anti-rabbit-AP antibody and wash 3 times 5 minutes each with 25 ml TBST buffer and 1 time in 25 ml alkaline phosphatase (AP) buffer. Finally, pour off the 1X AP buffer and add 10 ml of the chromogenic substrate (Gibco/BRL BCIP/NBT - 5-bromo-4-chloro-3-indoyl-phosphate/nitroblue tetrazolium). A photo of the image will be distributed for your notebook when the bands can be easily imaged (usually after ~ 10 minutes of development in the BCIP/NBT).

BCIP/NBT chemistry – alkaline phosphatase conjugated to the secondary antibody dephosphorylates BCIP resulting it its dimerization with the loss of a hydrogen ion which initially oxidizes NBT which upon subsequent spontaneous reduction forms a blue/brown precipitate which stains the membrane where the antibody-bound complex is found. BCIP:5-bromo-4-chloro-3-indolyl-phosphate; NBT: Nitro blue tetrazolium

Questions to answer in your notebook
Do you detect proteins of the predicted sizes? Go to the Saccharomyces Genome Database (SGD) to find the sizes of the untagged proteins then add 20 kDa? Use the molecular weight markers as a guide for sizes. Do the AP signal intensities reflect the relative abundance of each protein predicted by the SGD? That is, does the protein with predicted highest abundance (molecules per cell) show the brightest band and the protein predicted to have the lowest abundance of the three show the lightest AP signal?

1. Use of TAP-epitope tagged yeast strains to compare relative protein abundance, protein preparation, PAGE separation of proteins and western transfer, blocking and PAP “primary” antibody incubation, wash off PAP, incubate with goat anti-rabbit-alkaline phosphatase antibody, develop blot with BCIP/NTB reagents; review & interpret results 2. Genome editing with CRISPR-Cas9, transform Cas9-containing yeast with the CAN1 guide RNA expressing plasmid or an empty vector control, patch to –ura galactose plates to induce chromosomal GAL-Cas9 gene to stimulate CAN cleavage & mutagenesis, score experimental and control transformants on medium containing canavanine to learn if CAN1 gRNA directed Cas9 cleavage was effective; review & interpret results 3. Overview of mass spectrometry – Maldi-TOFand ESI-MS/MS methods

Wednesday 4. Molecular and Genetic Approaches to Identify Genes of Related Function - Brute force mutant screens & functional complementation; dosage suppression; extragenic suppression; synthetic lethality; Y2H, enhancer trap, transcriptomics, proteomics Forward genetics mutant screen (Prp38, Prp39) Dosage suppression (Spp381) Extragenic suppression & proteomics (Spp382, also guilt by association, Cwc23) Bioinformatics: Guilt by sequence similarity (Smd1, Prp42, Clf1) Synthetic lethality (Bud13, Cet1, Cwc2, and Rds3)

Course goal – to introduce students to a wide variety of fundamental techniques in molecular biology by direct experimentation So, what have we actually learned (in theory and practice)? To size select DNA by native agarose gel electrophoresis and purify this DNA in a state suitable for cloning. To prepare a plasmid vector for directional DNA cloning using restriction enzymes and alkaline phosphatase & DNA ligase To successfully recover recombinant clones from E. coli transformants by competent cell preparation, transformation & using a blue/white screening assay To purify plasmid DNA suitable for DNA sequence analysis (Qiagen prep) and use the returned sequence to identify the cloned DNA by BLAST database analysis. To prepare synthetic + and – strand RNA probes by in vitro transcription

To use size exclusion chromatography to purify synthetic RNA from unincorporated nucleotides
To successfully quantify and use radioisotopes for transcript detection on cellular RNAs separated by denaturing agarose gel electrophoresis To successfully isolate genomic DNA and intact total cellular RNA from a true eukaryote (baker’s yeast) To prepare a cDNA library from total RNA with reverse transcriptase To use the polymerase chain reaction (PCR) to: Identify wildtype and mutant alleles in yeast genomic DNA To create a site specific deletion by inverse PCR on plasmid DNA Quantify a nucleic acid by real time PCR Identify splice variants in total mRNA population To use nitrous acid for random chemical mutagenesis of a target gene (lacZ)

To identify sites of protein-protein interaction in vivo using the Yeast 2-Hybrid approach
To clone a gene by direct complementation of a genetic defect (PRP38/ts192) To use the plasmid shuffle with anti-metabolite 5-FOA as means of testing for gene function in a mutant set To use an epitope tag for protein purification via affinity chromatography (Prp43(1-121)-CBD/chitin-agarose) To use denaturing polyacrylamide gel electrophoresis to size fractionate proteins To use western blot transfer and antibodies against a common TAP epitope tag to quantify the relative abundance of 3 proteins To use RNA interference in C. elegans to successfully score gene function To use CRISPR-Cas9 to successfully target a gene for inactivation

To review the applications and meet the professional staff in the UK DNA sequencing, microarray and mass spectrometry core facilities and learn from a VP for research at a local successful biotech firm (Dr. Yeshi/Hera) To work together as a team to successfully complete this set of very challenging experiments.

Do the band migration reflect the relative sizes of these 3 proteins?
BY4746 – no TAP tagged protein present Pgk1-TAP Tda1-Tap Sup35-TAP NEB Broad Range Protein Markers Do the band migration reflect the relative sizes of these 3 proteins? Do the band migration reflect the actual lengths of these 3 proteins as estimated using the molecular weight markers? Are the relative abundances of Pgk1, Tda1 and Sup35 as predicted by SGD? Do the band migration reflect the predicted differences in amounts of these 3 proteins as estimated using SGD?

-uracil -adenine +canavanine
pRS426- empty vector pRS426-CAN1 guide RNA Did the CRISPR-Cas9 gene targeting of CAN1 work? How efficient was this process (% of patches that grew on +Can plate with gRNA expression)? Any evidence for “off target” inactivation of the dozen genes needed for adenine biosynthesis? Any evidence for “spontaneous” canavanine resistance?

Proteomics: identification of proteins present in complexes (tissues, organelles) to investigate the composition and characteristics of native and mutant/disease/induced/etc. states. What can you learn using mass spectrometry of proteins? The information gathered depends in part on the specific technology used and the questions asked. Here are some of the questions that may be answered: The identities of proteins residing within an organelle (e.g. mitochondria) or other complex protein mixtures (serum; large enzyme complexes; co-immune precipitation studies) Clinical typing of disease states based on protein composition and relative protein abundance in patient sera or other clinical samples Identification of drug targets The location and types of post-translational modifications on specific proteins The amino acid sequence of an unknown protein

Matrix Assisted Laser Desorption/Ionization (MADLI)
Two mass spectrometry approaches we will discuss: MALDI-TOF, ESI-Quadrupole ion trap – differ in ionization method and type of analyzer used for ion filtration The basics of mass spectrometry in the twenty-first century Gary L. Glish & Richard W. Vachet Nature Reviews Drug Discovery 2, (February 2003) Matrix Assisted Laser Desorption/Ionization (MADLI) Electrospray Ionization (ESI)

Proteomics & Mass Spectrometry: Complex mixtures of proteins can be compared by 2-dimensional electrophoresis* to define differences in pattern (due to changes in protein abundance or modification state). Individual proteins can be excised, digested with trypsin and then identified by mass spectrometry. 2-dimensional gels used for fractionation – first dimension electrofocusing that separates based on isoelectric point, second dimension standard SDS-PAGE that separates based largely on mass. (mass spectrometry video)

Matrix-assisted laser desorption ionization (MALDI) –Time of Flight (TOF) analysis (MALDI-TOF). Embed tryptic peptide mix in matrix compound on a solid support, target the matrix with a laser to bring peptides into gas phase & ionize peptide in an electric field. Focus the ions toward a detector to score mass/charge ratio. Compare these values to the conceptual proteome to identify specific protein(s) in the mix.

Electrospray Ionization (ESI) MS/MS – multiple ionization events per sample
(mass spectrometry video) Electrospray Ionization (ESI) in which the peptide mixture is heated & forced through a capillary tube in an strong electric field to emerge from a tiny orifice as a fine spay of charged droplets. The ions then enter the 4-pole (quadrupole) or related mass analyzer which focus/selects specific ions by alternating radio frequency (AC) and direct (DC) electrical current with associated magnetic fields for detection/identification.

Electrospray Ionization (ESI) MS/MS – multiple ionization events per sample

In tandem mass spectrometry (or MS/MS) ions with the mass-to-charge (m/z) ratio of interest (that is, parent or precursor ion) are selectively reacted to generate a mass spectrum of product ions by CID, collision-induced dissociation. Nature Reviews Drug Discovery 2, (February 2003) With CID, the parent ion collides with a neutral target (collision). This results in fragmentation of the parent ion peptide providing more detailed mass spectra to facilitate identification. MS/MS can be used for detailed peptide identification or de novo protein sequencing.

We used TAP selection MS/MS-ESI to identify proteins in the native spliceosome. J Biol Chem Mar 7;278(10): NTC proteins Spliceosome

a | Electrospray ionization (ESI) mass spectrum of the 12 kDa cytochrome c: multiple peaks are observed due to the different charge states that arise from varying degrees of protonation within a peptide (basic residues most readily charged). b | Matrix-assisted laser desorption/ionization (MALDI) mass spectrum of cytochrome c: only a single peak is observed for the analyte because ionization in MALDI generally occurs by the addition of a single proton. Note the different mass-to-charge (m/z) scales. Nature Reviews Drug Discovery 2, (February 2003)

Making Proteomics Quantitative - Post-labeling peptides to determine relative protein abundance
Isotope-coded affinity tags (ICAT) can be added to protein mixtures from different sources (e.g., cancer & healthy) to quantify changes in specific protein abundance. The principle is based on the fact that hydrogen (one proton) and deuterium (one proton plus one neutron) can be distinguished by mass spectrometry - hence a protein with modified with deuterium can be distinguished from the same protein containing only hydrogen. Two different ICATs used – one with hydrogen only the other with deuterium. Each sample gets modified with one of these alternative reagents then the samples mixed and analyzed.

In vivo labeling before protein isolation
Stable-isotope labeling with amino acids in cell culture (SILAC) uses light and heavy isotopes of nitrogen (N14, N15), carbon (C12, C13) or hydrogen (H1, H2). Here the labeling is done by the cells and does not require cysteine modification. The ratios of the same proteins present in the heavy and light samples are compared after normalization. The same ideal as ICAT except that the heavy/light isotopes are added normally during growth – works best for microbes or tissue culture.

PCA = protein fragment complementation (GFP, ubiquitin, etc.)
Protein capture

Two-hybrid, PCA, affinity selection approaches are physical interaction assays
Genetic interactions assays (e.g., synthetic lethality, dosage suppression) provide complementary information

Protein affinity capture (proteomic) information combined with genome wide genetic interaction maps, global gene expression studies and two-hybrid studies have been used to assemble the equivalent “social interaction networks” of related gene activities/proteins that describe cellular function.

Alternative Molecular and Genetic Approaches to Identify Genes of Related Function
*Brute force functional screens to find the mutant followed by complementation to relieve the lethal, conditional lethal (e.g., cold or heat sensitive) or severely impaired growth phenotype of an organism. This is most commonly used for selections, lower eukaryotic organisms, and tissue culture cells where it is possible to screen large numbers of different transformants. *Two hybrid interactions – define sets of genes whose gene products associate in vivo. Requires confirmation of pathway involvement. High Throughput Transcriptome (RNA Seq, Microarray, Nanodrop,etc.) to define coordinately regulated gene sets in tissue-specific or developmental stages; RNAs binding common proteins, etc.; requires confirmation of function *Proteomics – to isolate interacting proteins from cellular/tissue sources; guilt by association, proteins recovered together often function together; requires confirmation of function *Bioinformatics – proteins of related structure may have related function; requires confirmation of function

*High copy (dosage) suppression of a mutant phenotype for a gene encoding a functionally related gene whose overexpression suppresses the mutant defect in a gene of interest. Requires confirmation of pathway involvement. *Extragenic suppression - the identification of second site mutations that suppress the mutant defect of a mutation in a known gene of interest. Requires a scheme to identify the suppressor gene & confirmation of pathway involvement. *Synthetic lethal interactions – define sets of mutations that, when combined in the same genome, show much greater than additive defects. Synthetically lethal gene pairs often define genes contributing to the same biological process. Requires a scheme to identify the synthetic lethal gene & confirmation of pathway involvement. Enhancer trap experiments to define novel regulated genes by the random insertion of a readily scored marker gene (e.g., lacZ or GFP) into the genome. Look for tissue-specific (e.g., lung vs heart) or development stage-specific (e.g., embryonic vs adult) expression patterns to define genes that contribute to that stage.

Brute Force Screen and cloning by complementation.
Ts192 one of 300 temperature sensitive mutants isolated. Of these ~5% were defective in intron removal (pre-mRNA splicing). The gene responsible for one such mutant was cloned by complementation of the ts defect at 37C with a genomic DNA library (shown here as a PvuII DNA subclone). The gene was named PRP38. Blanton et al., MCB 12:3939, 1992 A: Northern blot, B: Primer extension experiment

“Replica plate” to identify the subset of ethyl methanesulfonate mutagenized yeast that are growth deficient at 37C (i.e., ts)

The cloned gene that reverses the temperature sensitivity or ts192 yeast might either
1) encode the wildtype allele of the mutant gene causing the ts lesion or 2) encode a suppressor gene that compensates for the original mutation but is located in a different gene. How might you tell the difference?

Show genetic linkage between the ts mutation and the cloned gene
Integrate the cloned DNA into its natural genetic locus by homologous recombination in the ts mutant strain Demonstration that the integrated DNA cannot be meiotically separated from the ts lesion by mating this strain with a fully wildtype yeast of opposite mating type. After this diploid is induced to undergo meiosis (i.e., sporulate), none of the haploid offspring are expected to show temperature sensitivity.

Identify the mutation in the original ts strain and demonstrate a causative difference in the cloned DNA. MAVNEFQVES NISPKQLNNQ SVSLVIPRLT RDKIHNSMYY KVNLSNESLR GNTMVELLKV 61 MIGAFG(D)TIKG QNGHLHMMVL GGIEFKC(Y)ILM KLIEIRPNFQ QLNFLLNVKN ENGFDSKYII 121 ALLLVYARLQ YYYLNGNNKN DDDENDLIKL FKVQLYKYSQ HYFKLKSFPL QVDCFAHSYN 181 EELCIIHIDE LVDWLATQDH IWGIPLGKCQ WNKIYNSDEE SSSSESESNG DSEDDNDTSS 241 ES* Two different ts alleles of PRP38 were identified by our lab. Each allele had a single bp change that resulted in a single amino acid substitution in the Prp38 protein, prp38-1 (G66D) and prp38-2 (C87Y).

Is Prp38 a Direct or Indirect Effector of Splicing?
Direct: a gene encoding protein or nucleic acid required for spliceosome assembly of function Indirect: a gene that regulates the expression (transcription, translation, stability) or a direct effector of splicing. For example, a transcription factor needed to specific for genes that encode spliceosomal subunits would be an indirect effector of splicing since it isn’t needed in the splicing reaction, per se, but is needed to express the genes that are required for the splicing reaction. How would you distinguish between these two possibilities?

Show that the mutation has the same ts phenotype in vitro in the absence of transcription or translation. In vitro splicing reaction: Here Prp38 is show to be ts for splicing in vitro. This defect can be complemented by the addition of active protein.

Phylogenetic conservation of function adds further support
Proc Natl Acad Sci U S A Feb 1; 90(3): 848–852. Convergent transcripts of the yeast PRP38-SMD1 locus encode two essential splicing factors, including the D1 core polypeptide of small nuclear ribonucleoprotein particles. B C Rymond SMD1 was identified as a gene adjacent to Prp38 in our sequence analysis. Smd1 was previously implicated in mammalian pre-mRNA splicing and we demonstrated it has a conserved role in yeast splicing.

Even more persuasively, the human SMD1 gene complements the yeast splicing deficiency – that is, the human protein promotes yeast splicing. Nucleic Acids Res Jul 25;21(15): Human snRNP polypeptide D1 promotes pre-mRNA splicing in yeast and defines nonessential yeast Smd1p sequences. Rymond BC1, Rokeach LA, Hoch SO. Abstract Parallel investigations of yeast and metazoan pre-mRNA splicing have documented enormous complexity in the nucleic acid and protein components of the cellular splicing apparatus, the spliceosome. The degree to which yeast and metazoan spliceosomal proteins differ in composition and structure is currently unknown. In this report we demonstrate that the human small nuclear ribonucleoprotein (snRNP) polypeptide D1 complements the cell lethality, splicing deficiency, and snRNA instability phenotypes associated with a yeast smd1 null allele. Mutational analysis of yeast SMD1, guided by a comparison of the predicted yeast and human proteins, reveals that a large, nonconserved portion of Smd1p is dispensable for biological activity. These observations firmly establish D1 as an essential component of the cellular splicing apparatus and suggest that yeast and metazoa are remarkably similar in the polypeptides guiding early snRNP assembly.

(example: define the set of genes required for intron removal)
Alternative Molecular or Genetic Approaches to Identify Genes of Related Function (example: define the set of genes required for intron removal) “Brute-force” forward genetics screen of a randomly mutagenized cells that fulfill the requirements of “splicing mutants”. Since pre-mRNA splicing is an essential process, these need to be “conditional” mutants that show increased “intron retention” (i.e., pre-mRNA accumulation) at the restrictive condition. Such studies identified many of the most critical and phylogenetically conserved “splicing factors”. These include ts or cs mutations that led to the cloning of at least 15 splicing factors: PRP2, PRP3, PRP4, PRP5, PRP6, PRP8, PRP9, PRP11, PRP16, PRP18, PRP24, PRP31, PRP38, PRP39, BRR2 The identification of this primary set led to subsequent genetic, bioinformatic and biochemical studies that greatly expanded this set. For instance, when we identified PRP38 we found an adjacent, convergently transcribed gene, SMD1, that encoded a protein with sequence similarity to a human protein, SmD1 implicated in the human autoimmune disorder, lupus erythematosus (Lupus). SmD1 was found to bind spliceosomal small nuclear RNAs by the Steitz lab. We showed that SMD1 is indeed essential for pre-mRNA splicing and that the human cDNA of this gene complements the splicing defects and lethality of yeast smd1 mutants. Primary Gene Found By TS Mutant Screen Second Gene Identified by Subsequent Bioinformatics PRP  SMD1

Alternative Molecular or Genetic Approaches to Identify Genes of Related Function
Functional complementation to relieve the lethal, conditional lethal (e.g., cold or heat sensitive) or severely impaired growth phenotype of an organism. This is most commonly used for selections, lower eukaryotic organisms, and tissue culture cells where it is possible to screen large numbers of different transformants. Two hybrid interactions – define sets of genes whose gene products associate in vivo. Requires confirmation of pathway involvement. High Throughput Transcriptome (RNA Seq, Microarray, Nanodrop,etc.) Approaches to define coordinately regulated gene sets in tissue-specific or developmental stages; RNAs binding common proteins, etc. High copy (dosage) suppression of a mutant phenotype for a gene encoding a functionally related gene whose overexpression suppresses the mutant defect in a gene of interest. Requires confirmation of pathway involvement. Extragenic suppression - the identification of second site mutations that suppress the mutant defect of a mutation in a known gene of interest. Requires a scheme to identify the suppressor gene & confirmation of pathway involvement. Synthetic lethal interactions – define sets of mutations that, when combined in the same genome, show much greater than additive defects. Synthetically lethal gene pairs often define genes contributing to the same biological process. Requires a scheme to identify the synthetic lethal gene & confirmation of pathway involvement. Enhancer trap experiments to define novel regulated genes by the random insertion of a readily scored marker gene (e.g., lacZ or GFP) into the genome. Look for tissue-specific (e.g., lung vs heart) or development stage-specific (e.g., embryonic vs adult) expression patterns to define genes that contribute to that stage.

How is a dosage suppressor screen performed?
Questions: How is a dosage suppressor screen performed? What types of genes will likely fulfill the requirements of such screens? How do demonstrate that the suppressor gene itself is required for the process under investigation? What might be the biochemical or molecular basis for genes acting as dosage suppressors?

Identification of dosage suppressors of the ts prp38-1 mutation.
Here a library of randomly cloned yeast genomic DNA on the high-copy number YEP13 plasmid introduced into the prp38-1 mutant, ts192. Colonies that grew at the restrictive temperature of 37C were identified as candidates that complemented or suppressed prp38-1 lethality. The plasmids were recovered from the ts192 yeast strain were sequenced. Sub-cloning portions of the YEP13-7 clone into plasmid YEplac112 was used to identify the gene responsible for suppression. The plasmids encode a functional PRP38 gene (YEp13-2), a weak suppressor of prp38-1 (YEp13-5), or an efficient suppressor of prp38-1 (YEp13-7 and YEplac112-7A). Identification of dosage suppressors of the Tsprp38-1 mutation. Yeast cultures were streaked on nonselective medium and incubated at 23 and 37°C. The colony sizes of the untransformed prp38-1 mutant and wild-type (PRP38) yeast strains are compared with those of theprp38-1 mutant transformed with the indicated multi-copy plasmids. The plasmids encoded a functional PRP38 gene (YEp13-2), a weak suppressor of prp38-1 (YEp13-5), or an efficient suppressor of prp38-1 (YEp13-7 and YEplac112-7A). Lybarger S et al. Mol. Cell. Biol. 1999;19:

Questions: How is a dosage suppressor screen performed?
What types of genes will likely fulfill the requirements of such screens? How do demonstrate that the suppressor gene itself is required for the process under investigation? What might be the biochemical or molecular basis for genes acting as dosage suppressors?

As expected for a suppressor of prp38-1, the recovered plasmid YEp17 and subclone YEplac112-7A greatly improve splicing efficiency in vivo (in the cell) as measured by decreased pre-mRNA to mRNA ratio (mRNA level increases) in the transformant compared to the untransformed mutant or negative control.

Prp38p 1 MAVNEFQVES NISPKQLNNQ SVSLVIPRLT RDKIHNSMYY KVNLSNESLR GNTMVELLKV 61 MIGAFGTIKG QNGHLHMMVL GGIEFKCILM KLIEIRPNFQ QLNFLLNVKN ENGFDSKYII ALLLVYARLQ YYYLNGNNKN DDDENDLIKL FKVQLYKYSQ HYFKLKSFPL QVDCFAHSYN EELCIIHIDE LVDWLATQDH IWGIPLGKCQ WNKIYNSDEE SSSSESESNG DSEDDNDTSS ES* Spp381p 1 MSFRHFKRRL DTSSADESSS ADEEHPDQNV SLTEKSASLS HSDLGGEILN GTGKNRTPND 61 GQESNESDGS PESDESPESE ESSDNSDSSD SDDMRPLPRP LFMKKKANNL QKATKIDQPW NAQDDARVLQ TKKENMIKNI DKANQVAKNY ETMKLRLNTN YSTNEELIKQ CLLLDDNDEV DSEKERQKWF ERQNERKQKH RRIQLAKQRE SEEYEAKRFE AMQKGKDGNT KYDVILDKEK EKLDHKKQRS AEKVEKSHNN NRYKITRTKN VEFGDLGKNS RDYEETEYSV I* The Prp38 and Spp382 proteins do not look much like one another beyond both being small acidic proteins. No protein sequence motifs (e.g., an RNA binding domain) within Spp381 offer insight into its function in splicing.

Questions: How is a dosage suppressor screen performed? What types of genes will likely fulfill the requirements of such screens? Just because Spp381 overexpression suppresses prp38-1 does not mean that Spp381 has a critical, independent role in splicing. How do demonstrate that the suppressor gene itself is required for the process under investigation? What might be the biochemical or molecular basis for genes acting as dosage suppressors?

Show defects in growth and splicing when the SPP381 function is lost
Here several new alleles were created to knockout the gene (spp381::LEU2), place the gene under GAL1 transcriptional control and epitope-tag the protein (GAL1::SPP381HA) and to test the role of the PEST domain (aa 56-95) implicated in protein stability (GAL1::spp381ΔPEST-HA)

Additional evidence we show in this paper implicating Spp381 in splicing:
SPP381 overexpression suppresses prp38-1 but does not complement a prp38::LEU2 null mutation - Spp381 assists the weakened Prp38-1 protein but does not replace it. Spp381 protein binds the spliceosome and, just like Prp38, associates with the U4/U6.U5 tri-snRNP subunit of the spliceosome Spp381 and Prp38 interact by the yeast two hybrid assay Subsequent studies by our group show that Prp38 and Spp381 play key roles in the catalytic activation of the spliceosome. Subsequent work by others have demonstrated that both proteins are phylogenetically conserved and that, in humans, Prp38 is critical for the recruitment of multiple other splicing factors needed for spliceosome function.

Primary Gene Found By TS Mutant Screen and the Second Gene Identified by:
PRP  SMD1 bioinformatics  SPP381 dosage suppression A number of other splicing factors have also been shown to act as dosage suppressors of various mutations in spliceosomal genes. Such studies are not restricted to yeast or to investigations of pre-mRNA splicing. This is a widely used and productive means to investigate gene function. High-copy gene expression assays have also been used in mammalian tissue culture and model system studies to identify oncogenes, genes that extend lifespan, promote cell differentiation, etc.

Questions: How is a dosage suppressor screen performed? What types of genes will likely fulfill the requirements of such screens? How do demonstrate that the suppressor gene itself is required for the process under investigation? What might be the biochemical or molecular basis for genes acting as dosage suppressors?

Suppressor genes that encode proteins that stabilize the ts mutant protein (protect from proteolysis) or help it fold into its proper conformation (shape) required for function. Some suppressor genes that encode proteins that normally directly interact with the target protein to promote function. The ts mutation in the target protein may reduce the stability stable complex formation and thereby reduce function (resulting in the ts phenotype). Making more of the suppressor protein might compensate for weakened association by increasing the frequency of interaction. That is, the rate of complex formation decreased by reduced affinity may be compensated by increased likelihood of interaction due to increased abundance of suppressor protein. Other ideas?

Functional complementation to relieve the lethal, conditional lethal (e.g., cold or heat sensitive) or severely impaired growth phenotype of an organism. This is most commonly used for selections, lower eukaryotic organisms, and tissue culture cells where it is possible to screen large numbers of different transformants. Two hybrid interactions – define sets of genes whose gene products associate in vivo. Requires confirmation of pathway involvement. High Throughput Transcriptome (RNA Seq, Microarray, Nanodrop,etc.) Approaches to define coordinately regulated gene sets in tissue-specific or developmental stages; RNAs binding common proteins, etc. High copy (dosage) suppression of a mutant phenotype for a gene encoding a functionally related gene whose overexpression suppresses the mutant defect in a gene of interest. Requires confirmation of pathway involvement. Extragenic suppression - the identification of second site mutations (mutations in other genes) that suppress the mutant defect of a gene of interest. Requires a scheme to identify the suppressor gene & confirmation of pathway involvement. Synthetic lethal interactions – define sets of mutations that, when combined in the same genome, show much greater than additive defects. Synthetically lethal gene pairs often define genes contributing to the same biological process. Requires a scheme to identify the synthetic lethal gene & confirmation of pathway involvement. Enhancer trap experiments to define novel regulated genes by the random insertion of a readily scored marker gene (e.g., lacZ or GFP) into the genome. Look for tissue-specific (e.g., lung vs heart) or development stage-specific (e.g., embryonic vs adult) expression patterns to define genes that contribute to that stage.

Extragenic suppression – spread large numbers of temperature sensitive prp38-1 mutant (ts192) yeast on agar plates at 37C. The vast majority of these yeast die. However, a few colonies do form at 37C and these have the potential to have either reversion or intragenic suppressor mutations of prp38-1 allele or be second site (extra-genic) suppressors – that is, mutations in other genes that when combined with prp38-1 allow the yeast to grow at 37C. SPP382 was found in this way.

SPP382 is an essential gene and, as expected for a splicing factor, loss of Spp382p activity impairs splicing Turning off Spp382 transcription by repression of a GAL1-SPP382 promoter fusion blocks splicing Loss of Spp382p activity impairs splicing. (A) Northern analysis of splicing inhibition in yeast that express the nutritionally regulated GAL1::spp382-4 gene (T = 0) and 4–20 h after transcriptional repression by glucose. Wild-type yeast (SPP382) were assayed in parallel grown in galactose (T = 0) or glucose (T− = 20) media. The positions of the intronless ADE3 mRNA and the RPS17A premRNA and mRNA are shown to the left. (B Upper) Northern blot analysis as in A with wild-type yeast, the prp38-1 mutant, and the nonlethal spp382 mutants grown at room temperature (−) or after 2 h at 37°C (+). (B Lower) Accumulation of the ACT1 excised intron RNA. (C) Splicing of the prp38-1 mutant and the prp38-1, spp382-1 double mutant at 23°C and after 2 h at 37°C (+). The 25S and 18S rRNA bands are presented as normalization controls for RNA loading and transfer. A variety of spp382 point mutants show splicing defects that include decreased splicing efficiency and increased abundance of the excised intron. Pandit S et al. PNAS 2006;103:

Yes, we found that prp43 mutants also suppress the prp38-1 mutation.
Intron accumulation is consistent with decreased dissociation of the post-catalytic spliceosome since spliceosomal proteins protect the excised intron from degradation. Prp43 is the RNA helicase needed to dissociate the post-catalytic spliceosome. Is it possible that reduced Prp43 activity might also suppress splicing defects? Yes, we found that prp43 mutants also suppress the prp38-1 mutation. Importantly, the degree of prp38-1 suppression was proportionate to the level of residual ATPase activity remaining in the prp43 point mutants. Prp43 functions as a splicing “fidelity factor”

We previously demonstrated that prp38 mutants efficiently assemble spliceosomes but that the rate of catalysis is slow – the spliceosomes are “built” but splice slowly due to poor catalytic activation. These observation led to an important new hypothesis: That Prp43, in addition to functioning to recycle the post-catalytic spliceosome, also monitors spliceosome assembly to dissociate kinetically impaired or otherwise defective spliceosomes. That is Prp43 and its activator, Spp382, play a critical role in the spliceosome discard pathway (long believed to exist but uncharacterized) to remove defective splicing complexes in order to prevent toxic or otherwise undesired mis-splicing events. We propose that reduced spliceosome turnover resulting from SPP382 or PRP43 mutation suppresses prp38-1 mutants by allowing more time for the catalytically impaired (i.e. slow) spliceosome to work before dissociation. Lots of subsequent work by my lab and others (Staley, Beggs, Cheng, & Lurhmann groups) have proven features of this hypothesis correct.

Primary Gene Found By TS Mutant Screen and a Second Gene Identified by
PRP  SMD1 bioinformatics  SPP381 dosage suppression  SPP382 and AAR2 extragenic suppression Defective spliceosomes can result from inappropriate assembly on pre-mRNA or in response to defects in the pre-mRNA sequence or spliceosome composition– in mammals, these might be assembling a spliceosome that will promote a liver-specific splicing event in the brain. These are believed to occur frequently and must be removed – how these are identified and mechanism of dissociation remain as important unanswered questions under investigation by our group and others. In addition to Spp382, several other splicing factors have also been shown to act as extragenic suppressors in defined steps of spliceosome assembly.

Functional complementation to relieve the lethal, conditional lethal (e.g., cold or heat sensitive) or severely impaired growth phenotype of an organism. This is most commonly used for selections, lower eukaryotic organisms, and tissue culture cells where it is possible to screen large numbers of different transformants. Two hybrid interactions – define sets of genes whose gene products associate in vivo. Requires confirmation of pathway involvement. High Throughput Transcriptome (RNA Seq, Microarray, Nanodrop,etc.) Approaches to define coordinately regulated gene sets in tissue-specific or developmental stages; RNAs binding common proteins, etc. High copy (dosage) suppression of a mutant phenotype for a gene encoding a functionally related gene whose overexpression suppresses the mutant defect in a gene of interest. Requires confirmation of pathway involvement. Extragenic suppression - the identification of second site mutations that suppress the mutant defect of a mutation in a known gene of interest. Requires a scheme to identify the suppressor gene & confirmation of pathway involvement. Synthetic lethal interactions – define sets of mutations that, when combined in the same genome, show much greater than additive defects. Synthetically lethal gene pairs often define genes contributing to the same biological process. Requires a scheme to identify the synthetic lethal gene & confirmation of pathway involvement. Proteomics – to define interacting protein sets Bioinformatics – computational approaches applied in different ways, shown here through the identification of proteins with similar structures

Inhibition of a spliceosome turnover pathway suppresses splicing defects. Shatakshi Pandit, Bert Lynn , and Brian C. Rymond, 2006, PNAS, 103, 13700–13705. The same paper which reported the isolation of SPP382 and PRP43 mutants as extragenic suppressors of prp38-1, also used proteomics to identified the Cwc23 protein as tightly associated with Spp382. Spp382-TAP was used for tandem affinity purification under high stringency conditions in the hopes of finding proteins that bind directly to Spp382. Most proteomics are done in mM salt (NaCl or KCl), we used 450 mM NaCl which is sufficient to remove all but the most tightly held interactors.

Cwc23 was also seen to interact with Spp382 by the Y2H assay.
Interaction tested Mass score Peptides Spp382-TAP proteins Cwc23p 114 3 Rpl14Ap 60 1 Rpl4Ap 27 Rep2p 23 Rrp5p 20 Two-hybrid clone Act:DB* 20 mM 3AT SPP382::Empty — SPP382::CWC23 +++ CWC23::SPP382 CWC23::Empty WT (HIS3) yeast ++++ Only one protein previously shown to be associated with the spliceosome was found, Cwc23. Cwc23 was also seen to interact with Spp382 by the Y2H assay. Activation domain (Act) and DNA binding (DB) domains. ↵*Relative colony sizes after 3 days at 30°C.

And, through the now familiar approach (splicing assay of a cwc23 null allele) we showed Cwc23 to be important for splicing and for the turnover (degradation) of the excised intron product – the latter feature common to spp382 and prp43 mutants as well. Too much Cwc23 was also found to inhibits splicing. Spp382p Interacts with Multiple Yeast Splicing Factors, Including Possible Regulators of Prp43 DExD/H-Box Protein Function Shatakshi Pandit, Sudakshina Paul, Li Zhang , Min Chen, Nicole Durbin, Susan M. W. Harrison and Brian C. Rymond, Genetics. 2009, Genetics, 183:

3. Use of TAP-epitope tagged yeast strains to compare relative protein abundance, protein preparation, PAGE separation of proteins and western transfer, blocking and PAP “primary” antibody incubation, wash off PAP, incubate with mouse anti-rabbit-alkaline phosphatase antibody, develop blot with BCIP/NTB reagents 4. Genome editing with CRISPR-Cas9, transform Cas9-containing yeast with the CAN1 guide RNA expressing plasmid or an empty vector control, patch to –ura galactose plates to induce chromosomal GAL-Cas9 gene to stimulate CAN cleavage & mutagenesis, score experimental and control transformants on medium containing canavanine to learn if CAN1 gRNA directed Cas9 cleavage was effective

(When you do not have a DNA or peptide sequence in hand)
Alternative Molecular or Genetic Approaches to Identify Genes of Related Function Functional complementation to relieve the lethal, conditional lethal (e.g., cold or heat sensitive) or severely impaired growth phenotype of an organism. This is most commonly used for selections, lower eukaryotic organisms, and tissue culture cells where it is possible to screen large numbers of different transformants. Two hybrid interactions – define sets of genes whose gene products associate in vivo. Requires confirmation of pathway involvement. High Throughput Transcriptome (RNA Seq, Microarray, Nanodrop,etc.) Approaches to define coordinately regulated gene sets in tissue-specific or developmental stages; RNAs binding common proteins, etc. High copy (dosage) suppression of a mutant phenotype for a gene encoding a functionally related gene whose overexpression suppresses the mutant defect in a gene of interest. Requires confirmation of pathway involvement. Extragenic suppression - the identification of second site mutations that suppress the mutant defect of a mutation in a known gene of interest. Requires a scheme to identify the suppressor gene & confirmation of pathway involvement. Synthetic lethal interactions – define sets of mutations that, when combined in the same genome, show much greater than additive defects. Synthetically lethal gene pairs often define genes contributing to the same biological process. Requires a scheme to identify the synthetic lethal gene & confirmation of pathway involvement. Proteomics – to define interacting protein sets Bioinformatics – computational approaches applied in different ways, shown here through the identification of proteins with similar structures

removal (i.e., splicing) in vivo.
Commitment of yeast pre-mRNA to the splicing pathway requires a novel U1 small nuclear ribonucleoprotein polypeptide, Prp39p. Lockhart SR1, Rymond BC. Mol Cell Biol. 1994, 14: Bioinformatics – genes/proteins of related structure may have related functions. Foundational observation: Our original ts mutant screen that identified PRP38, also identified the gene encoding the U1 snRNP protein and essential pre-mRNA splicing factor, Prp39. Metabolic depletion of Prp39 by transcriptional repression of the GAL1-PRP39 promoter fusion blocks intron removal (i.e., splicing) in vivo. Immune precipitation of a hemagglutinin (HA) tagged Prp39HA protein, co-purifies the spliceosomal U1 small nuclear RNA (snRNA)

The Prp39 protein showed 50% overall sequence similarity to an unidentified open reading frame (ORF) in yeast which we named the PRP42 gene. The greatest sequence identity were within a set of degenerate 34 amino acid repeats (tetratricopeptide [TPR] repeats) previously found in several fungal cell cycle proteins.

Yeast pre-mRNA splicing requires a pair of U1 snRNP-associated tetratricopeptide repeat proteins. McLean MR1, Rymond BC., 1998, Mol Cell Biol. 18: Like Prp39, Prp42 was shown to be essential for viability and pre-mRNA splicing, to associate with the U1 snRNA.

And Prp43 protein is required for the assembly of the full U1 small nuclear ribonucleoprotein (snRNP) particle. Native agarose/polyacrylamide gels used to separate endogenous yeast snRNP particles which were transferred to positively charged nylon membranes and probe for the spliceosomal snRNAs. Antibodies against an HA epitope tagged Prp42 uniquely super-shift the U1 snRNP particle. B. Metabolic depletion of Prp43 by transcriptional repression of a GAL1-PRP42 promoter fusion, reduces U1 snRNP mobility due to the loss of Prp42

PRP39 -------------------------------------------------- PRP42 bioinformatics

In addition to noting that Prp39 and Prp42 had multiple TPR repeats, we identified an uncharacterized gene that encoded a protein that contained 15 direct repeats of the 34 amino acid TPR domain. We called this gene CLF1 (for Crooked Neck Like Factor 1) after a related Drosophila gene suggested to be a cell cycle factor. N->->->->->->->->->->->->->->->C Clf1 is an odd protein and composed almost entirely of 15 direct repeats of the TPR protein binding domain with no sequence between the repeats.

Using techniques similar to those described above for other genes, we went on to demonstrate that Clf1 was actually an essential pre-mRNA splicing factor and a core component of the spliceosome in yeast and humans: Yeast ortholog of the Drosophila crooked neck protein promotes spliceosome assembly through stable U4/U6.U5 snRNP addition. 1999, Chung S, McLean MR, Rymond BC. RNA. 8: The Clf1p splicing factor promotes spliceosome assembly through N-terminal tetratricopeptide repeat contacts Wang Q, Hobbs K, Lynn B, Rymond BC. J Biol Chem. 278: Crooked neck is a component of the human spliceosome and implicated in the splicing process Chung S, Zhou Z, Huddleston KA, Harrison DA, Reed R, Coleman TA, Rymond BC. Biochim Biophys Acta.1576:

Do the band migration reflect the relative sizes of these 3 proteins?
BY4746 – no TAP tagged protein present Pgk1-TAP Tda1-Tap Sup35-TAP NEB Broad Range Protein Markers Do the band migration reflect the relative sizes of these 3 proteins? Do the band migration reflect the actual lengths of these 3 proteins as estimated using the molecular weight markers? Are the relative abundances of Pgk1, Tda1 and Sup35 as predicted by SGD? Do the band migration reflect the predicted differences in amounts of these 3 proteins as estimated using SGD?

Transform an empty vector copy of pRS426-U6 as a control.
Patch the transformants on –ura galactose medium to transcriptionally induce Cas9 in the experimental strain. Screen for colony color after Cas9 induction (probably best done by streaking for single colonies). A successful experiment with inactivate XER1 and the colonies will be bright red rather than purple. Expect the red colonies only with the pRS426-U6-XER1 transformant. If further confirmation is needed, the XER1 gene could be PCR amplified and sequenced from purple and red colonies to identify the Cas9-direct mutations.

PRP39 -------------------------------------------------- PRP42 bioinformatics
CLF1 bioinformatics

(When you do not have a DNA or peptide sequence in hand)
Alternative Molecular or Genetic Approaches to Identify Genes of Related Function Functional complementation to relieve the lethal, conditional lethal (e.g., cold or heat sensitive) or severely impaired growth phenotype of an organism. This is most commonly used for selections, lower eukaryotic organisms, and tissue culture cells where it is possible to screen large numbers of different transformants. Two hybrid interactions – define sets of genes whose gene products associate in vivo. Requires confirmation of pathway involvement. High Throughput Transcriptome (RNA Seq, Microarray, Nanodrop,etc.) Approaches to define coordinately regulated gene sets in tissue-specific or developmental stages; RNAs binding common proteins, etc. High copy (dosage) suppression of a mutant phenotype for a gene encoding a functionally related gene whose overexpression suppresses the mutant defect in a gene of interest. Requires confirmation of pathway involvement. Extragenic suppression - the identification of second site mutations that suppress the mutant defect of a mutation in a known gene of interest. Requires a scheme to identify the suppressor gene & confirmation of pathway involvement. Synthetic lethal interactions – define sets of mutations that, when combined in the same genome, show much greater than additive defects. Synthetically lethal gene pairs often define genes contributing to the same biological process. Requires a scheme to identify the synthetic lethal gene & confirmation of pathway involvement. Proteomics – to define interacting protein sets Bioinformatics – computational approaches applied in different ways, shown here through the identification of proteins with similar structures

Clf1 used in a synthetic lethal screen to identify interacting genes as candidates for other pre-mRNA splicing factors. Genetic interactions with CLF1 identify additional pre-mRNA splicing factors and a link between activators of yeast vesicular transport and splicing Vincent K, Wang Q, Jay S, Hobbs K, Rymond BC. Genetics. 164: Synthetic lethality – interaction between weak mutations in two different genes whose combination in the same haploid cell results in lethality. Here shown for two single copy genes, called X and Y in a haploid genetic background: Genotype Phenotype WT-X, WT-Y wildtype growth X, y-1 slight growth inhibition, nearly normal X-1, Y slight growth inhibition, nearly normal X-1, y-1 dead (synthetic lethal) or extremely poor growth (synthetic sick) The word “synthetic” refers combining the two mutations in the same cell.

Starting with the CLF1 gene, we use inverse PCR to delete TPR units and demonstrate that not all TPR repeats are identical in function via plasmid shuffle. Add-back experiment in which PCR fragments containing the original TPR2 segment or TPR1 or TPR3 sequences are placed in the clf1Δ2 allele. Only the cognate (i.e., original) TPR2 rescues the ts clf1Δ2 mutant phenotype at 37C.

Genetic basis of this synthetic lethal screen
Genetic basis of this synthetic lethal screen. Requires a yeast host strain containing chromosomal null allele of CLF1 as well as chromosomal marker genes (clf1::LEU2, trp1, ura3, leu2, ade2, ade3 ) and , a plasmid containing a wildtype CLF1 allele plus a wildtype copy of the URA3 and ADE3 genes (p2965, CLF1, URA3, ADE3), and a plasmid with the ts clf1Δ2 allele plus TRP1 (YCplac22, clf1Δ2, TRP1). Red/white color assay Genotype Colony color ADE2, ADE3 white ade2, ade3 white ade2, ADE3 RED ADE2, ade3 white Note that in this genetic background, the host chromosome has recessive ade2, ade3 mutations but carries a functional (i.e., complementing) ADE3 gene on the plasmid bearing the wildtype CLF1 (p2965). What color should this starting strain be, red or white?

Red/white color assay Genotype Colony color ADE2, ADE3 white ade2, ade3 white ade2, ADE3 RED ADE2, ade3 white ade2, ade3, ADE3 RED However, just as in our plasmid shuffle experiment, the yeast can spontaneously lose one or the other plasmid. If the p2965 (CLF1, URA3, ADE3) plasmid is lost, what color will the colonies be?

Plasmid loss results in white sectors (stripes) on red colonies
Plasmid loss results in white sectors (stripes) on red colonies . However, for synthetic lethal mutants, every time the cell loses plasmid p2965 (CLF1, URA3, ADE3) it DIES. Consequently, the synthetic lethal mutants are solid red color (as these MUST retain the p2965 plasmid). Predicted phenotype of the desired synthetic lethal mutants: solid red color, FOA-, and possibly compromised in pre-mRNA splicing defective. Mutagenesis was conducted with ethyl methanesulfonate (EMS) to identify yeast that have second site mutations (that is, outside of CLF1) that are lethal when paired with the plasmid based clf1Δ2 plasmid (YCplac22, TRP1, clf1Δ2). Note that since our host is ura3 mutant and p2965 has a complementing URA3 gene, the desired synthetic lethal mutants are also expected to be 5-florooritic acid minus (FOA-) (i.e., not able to grow on FOA medium).

Twelve mutants were found that show synthetic growth defects when combined with clf1Δ2. These include genes encoding the previously identified Mud2, Ntc20, Prp16, Prp17, Prp19, Prp22, and Syf2 splicing factors and four proteins without established contribution to splicing (Bud13, Cet1, Cwc2, and Rds3). By deletion analysis and assays for splicing, we subsequently established roles for RDS3, CET1 and BUD13 in pre-mRNA splicing. Bud13, Cwc2, Rds3 bind the spliceosome while Cet1 encodes the phosphatase required for mRNA (and snRNA) 5’ cap formation. We performed subsequent proteomic studies on Rds3 and Bud13 to identify additional components of the yeast splicing apparatus and multiple physical and genetic interactions among this protein set. Rds3p is required for stable U2 snRNP recruitment to the splicing apparatus. 2003, Wang Q1, Rymond BC. 2003, Mol Cell Biol.23: Interactions of the yeast SF3b splicing factor. Wang Q1, He J, Lynn B, Rymond BC Mol Cell Biol 25:

(SMD3) PRP  PRP42 bioinformatics  CLF1 bioinformatics BUD13, CET1, CWC2, and RDS3 synthetic lethality YCP10/YSF3 proteomics

Quiz #4 Goal: Find the actin binding site on tubulin Approach: Yeast Two-Hybrid Assay (Y2H) Overview: Use recombinant DNA techniques to create a gene that produces a protein fusion between the DNA binding domain of the Gal4 protein and the full-length actin protein. This is done on a yeast/E. coli shuttle vector plasmid (e.g., pAS2) with bacterial selection (ampR) and a selectable marker gene to select transformants (TRP1) plus appropriate replication origins. Use recombinant DNA techniques to create a gene that produces a protein fusion between the transcriptional domain of the Gal4 protein and full-length tubulin or various overlapping portions of the tubulin protein. This is done on a yeast/E. coli shuttle vector plasmid (e.g., pACT2) with bacterial selection (ampR) and a selectable marker gene to select transformants (LEU2) plus appropriate replication origins. Minimum yeast host gene requirements: mutant for trp1, leu2, his 3 and the presence of at least one reporter gene that provides a readout of a successful Y2H interaction – we used GAL1-HIS3.

Basic experiment: Co-transform the pACT2 and pAS2 construct combinations into the yeast host strain. Select double transformants on medium that lacks leucine and tryptophan. Take individual colonies off the –trp –leu plate and score for GAL1-HIS transcriptional activation (i.e., + Y2H response) on medium that lacks histidine (and may contain 3 aminotriazole). Good to include empty vector negative controls for both pAS2 and pACT2. Data analysis: Yeast that grown on the medium that lacks histidine encode peptides that interact. Those that fail to grow on minus histidine medium do not. By scoring all clones and knowing the boundaries of each clone, you may be able to define sequences that, when removed, appear to block interaction – that is, are necessary for the Y2H response. To determine whether a sequence necessary for interaction in a set of overlapping clones is sufficient for the Y2H response, clone the area in common as a stand-alone Y2H construct and score for its interaction with the actin clone.

Common errors: Selectable marker genes are used to identify plasmid transformants. These often include genes for amino acid biosynthesis (TRP1, LEU2) or nucleotide biosynthesis (URA3, ADE3). Reporter genes are used to score for a positive biological response in a biological assay, for instance transactivation in the Yeast Two Hybrid Assay. Here we scored for reconstitution of the Gal4 transcriptional activator by stimulation of the GAL1-HIS reporter gene and growth on medium that lacks histidine. Confusion of genes and gene products: Leu is the three letter abbreviation for the amino acid leucine. LEU2 is one of several genes that encode protein enzymes required for the biosynthesis of leucine. Neither leu nor leucine is a gene and LEU2 is not an amino acid. Plasmids do not encode leucine but may carry a gene necessary for leucine biogenesis (e.g., LEU2, LEU4, etc.). Common practice is to write the names of recessive mutant genes in small case, italic letters (or underline) where specific allele designations are given as a number: leu2-3 (a recessive mutant of LEU2).

Welcome BIO510 Recombinant DNA Techniques Lab

Similar presentations

Presentation on theme: "Welcome BIO510 Recombinant DNA Techniques Lab"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Welcome BIO510 Recombinant DNA Techniques Lab

Similar presentations

Presentation on theme: "Welcome BIO510 Recombinant DNA Techniques Lab"— Presentation transcript:

Similar presentations

About project

Feedback