1. Microarrays Lawrence Berkeley National Lab
Center for Environmental Biotechnology
Todd DeSantis, Sonya Murray, Jordan Moberg, Gary Andersen

2. The ponderings of a pre-schooler
Why can’t I watch Shrek 3 times per day?
Will the swings be wet at the park?
How will this lactose impact the diversity in my lower G.I. bacterial community?
Will I inhale any archaeal microorganisms when I visit the hot springs?
Microarrays can help answer these types of questions.
Will I be as bald as my Dad?
Vincent DeSantis

3. What can they do?
Determine if a particular biological macromolecule is in a complex sample.
Examples of biological macromolecules:
Microarrays can also quantify the abundance.

4. One-of-a-kind foot
Molecule of interest is identified by some unique feature.
Cinderella is identified by her unique foot.
The foot is the “target” to be sought.
If her foot was common to all women, then would her foot be useful target?
Unique molecular features (targets).
DNA or RNA  sequence of ACGT(U)
Proteins  AA, Epitopes
Lipids ?
Carbohydrates  branch structure

5. Need a perfect slipper
Molecule of interest (target) must capture, or be captured by, a second molecule (probe).
Many feet had to be evaluated by an easy test.
The specific, not common, glass slipper was used as the test (probe).
Unique molecular probes.
DNA or RNA  DNA or RNA (Oligo nt).
Proteins  Proteins (Antibodies)
Lipids ?
Carbohydrates ?
My focus: DNA targets probed with complementary DNA

6. DNA Pairing Fundamentals
Adenine (A) pairs with Thymine (T)
Cytosine (C) pairs with Guanine (G)
The two DNA strands are held together by _______ bonds
“Complimentary Strands”

7. Base-pairing allows DNA:DNA or DNA:RNA

8. Example application D+ D- Label all mRNA, expose to probes
Do Diabetic patients have lower glycogen synthase levels compared to healthy individuals?
Analyze RNA, determine specific target
5’...UAUUAGCGCUCGAUCGCUUAGUACAGCGAGGAAAAGUCCGAUAGUAC...3’
Synthesize DNA probe
3’ ATCATG 5’
Attach probe to a surface.
Nylon sheet
Plastic dish
Glass slide
Prepare samples
Label all mRNA, expose to probes D+
Extract mRNA from skeletal muscle sample D-
Diabetes 51: , 2002 Gene Expression Profile in Skeletal Muscle of Type 2 Diabetes and the Effect of Insulin Treatment, Sreekumar, et al.

9. Hybridization Notice all mRNA is labeled (florescence)
Non-binding mRNA is washed away
If surface “glows”, then target was captured by probe.
What does it mean if no “glow” is detected?

10. Example Results D+ D- Membrane with glycogen synthase probe attached *
Labeled mRNA*
Wash * * * * * * D- * * * * * * *

11. Red-Green

12. Millions of copies per feature

13. Photolithography Affymetrix - Photolithography
Nimblegen – microscopic independent mirrors to direct light.

14. Coordinates of fluorescence determines test results.

15. 500,000 Probe 16S array
(DOE 16S Chip)

16. What “bugs” are in my sample?
Rapid taxonomic classification of complex consortia of environmental rDNA using a microarray.
Environmental Surveys
Counter Bio-terrorism
Bioremediation
Clinical Investigations

17. Example Microorganisms
C. immitis
B. anthracis
Plus thousands more ....
Lung

18. Project Overview
Goal
Create a single microarray capable of detecting and categorizing the bacteria in a complex sample.
Approach
GeneChip targeted at 16S rDNA sequence variations to distinguish taxa.

19. The Ribosome
rDNA
rRNA (functional molecule)
LSU
SSU
16s or 18s

20. Foundations: Maintain the largest 16S gene library (~83,000).
Cluster sequences into taxa (~10,000).
Create algorithm for picking probes for each taxa (~500,000).

21. Probe set: 02280401041000.2154 Sequence discrepancies
Desulfovibrio sp. str. DMB.
Desulfovibrio sp. 'Bendigo A'
Desulfovibrio vulgaris DSM 644
Sequence discrepancies
Regions not unique to taxon
Regions unique to taxon
Probe set:

22. Contains probes adhered to glass surface in grid pattern.
General Protocol
Run Video
Air
Soil
Feces
Blood
Water
gDNA
Universal 16S rDNA PCR
rRNA
Contains probes adhered to glass surface in grid pattern.

23. Probes for C. jejuni tiled in 4 areas
C. jejuni probe sets
45 deg C
48 deg C
50 deg C
d_st
3015
2219
1927
c_st
3011
2303
2126
b_st
3166
2397
2548
_st
3162
2320
2291
mean:
3088
2309
2223
standard deviation: 87 73
263
coefficient of variation:
0.03
0.12
Reproducibility 

25. Counter Bio-Terrorism
Sampling the Air
Extracting DNA
Hybridization
PCR
Single Organism Detection
Detection Arrays for Multiple Organisms

26. Traditional Detection
Collect air sample
Swab sample onto petri dish
Wait 2 days to 4 weeks for organisms to grow
Isolate
Biochemical tests
Visual Inspection

27. PCR
Polymerase Chain Reaction
Makes many DNA copies from few

28. Hybridization Occurs Between Complimentary Strands
Join properly when cooled
Separate when heated

29. Probes Search for Targets

30. Probes Search for Targets

31. DNA Replication Foundations
DNA Polymerase
enzyme which “xeroxes” a single strand in to a double strand
assembles dNTPs monomers into a polymeric strand
adds dNTPs to 3’ end of polymer
Poly G A C T

32. Polymerase Chain Reaction (PCR)
An in vitro technique for creating many copies of a gene segment
Components
polymerase
template DNA
dNTPs (individual A, C, G, or T)
Small probes called “primers”
Poly G A C T
Let’s do it...

33. Polymerase Chain Reaction (PCR)
95°
Hot temperature ensures template is single stranded. A G T C
3’-
- 5’
Single stranded template to be “xeroxed”

34. Polymerase Chain Reaction (PCR)
95°
Primer designed by lab A G G C C A A
5’- A T T G T G
- 3’ G A A C A G T C
3’-
- 5’

35. Polymerase Chain Reaction (PCR)
55°
Lowering temperature allows hydrogen bonding to form A G G C C A A
5’ - A T T G T G
- 3’ G A A C A G T C
3’ -
- 5’

36. Polymerase Chain Reaction (PCR)
72°
Polymerase can act upon free 3’ end when it has bound to the template.
Poly G A C T
5’ - A A A G
- 3’ G T G C T T G A A C G T C A A G A T T T A G
3’ - G C T G T C G A A C T T G C A G T T C C C
- 5’ G G A A G G A A
Temperature raised to optimize polymerase activity

37. Polymerase Chain Reaction (PCR)
72°
Polymerase can act upon free 3’ end when it has bound to the template.
Poly G A C T
5’ - A A G A A T C G T G C T T G A A C G T C A A G A C A A T T T A G G G C
- 3’
3’ - G C T G T C T T C G A A C T T G C A G T T C C C C C T T
- 5’ G G A A G G A A
Temperature raised to optimize polymerase activity

38. career preparation
Do a Senior Project that involves both CS and BIO students
Find Mentor
Interview, Interview, Interview (on campus, off-campus, maintain contacts)
Learn HTML/Perl/Java/CGI

39. Attractive Perl Properties:
Forgiving syntax
Interpreted, not compiled
Platform independent
Text manipulation
Libraries, modules, etc.
Object oriented optional

40. Why Perl is the leading language of Bioinformatics?
Perl easy to learn
Perl is powerful
Perl is free
Large support group:
Interfaces easily to relational databases
In fact, it has been claimed that Perl saved the Human Genome Project

41. Examples:
Find all the genomic 20-mers in common between Vibrio cholera str.14 and Vibrio mimicus
This could take a long time by hand.
V.choler TTGTACACACCGCCCGTCACACCATGGGAGTGGNCTGCAAAAGA-GCAGGTAGTTTAACC...
V.mimicus ...TTGTACACACCGCCCGTCACACCATGGGAGTGGGCTGCAAAAGAAGCAGGTAGTTTAACC...

42. Probe Finding Project Given: Purpose: Method: one microbial taxon
Describe its taxonomic placement.
Find two interesting things about the organisms in that taxa.
Find a probe that is specific for a group of organisms.
Method:
Obtain 16S Sequences.
Align them to each other (MSA)
Determine best target from a short list (provided).
Verify that probe exists in all/most orgs of taxa
Check for X-hybe (non-specificity)
Check w/in sub-division, not all sequences

43. Start Here

44. Answers (Targets) Oceanospirillum Streptococcus Rhodococcus
TGCTACTTCGCCGGCGAGCGGCGGA
Streptococcus
CTTGACATCCTTCTGACCGGCCTAG
Rhodococcus
CGGGTCTCTGGGAAACAACTGACGC
TGGGAAACAACTGACGCTGAGGAAC
Methanocorpusculum
TGGAGAATACTCCCGGGAAACTGGG
Desulfovibrio
GCGTGAAAGGACTTCGGTCCGAGTA

45. Multi Microarray Analysis
Track a bio-marker over many experiments.
Download file
Fluorescence intensity for118 taxa reported for 5 experimental conditions, and a negative control.
Find
Taxa with highest intensity overall.
Possible PCR contaminants
Taxa with greatest intensity fluctuation overall
Condition producing the brightest signal for Paracoccus yeeii?