1. Lawrence Berkeley National Lab Center for Environmental Biotechnology Todd DeSantis, Sonya Murray, Jordan Moberg, Gary Andersen Microarrays

2. The ponderings of a pre-schooler Why can’t I watch Shrek 3 times per day? Will the swings be wet at the park? How will this lactose impact the diversity in my lower G.I. bacterial community? Will I inhale any archaeal microorganisms when I visit the hot springs? Vincent DeSantis Microarrays can help answer these types of questions. Will I be as bald as my Dad?

3. What can they do? Determine if a particular biological macromolecule is in a complex sample. Examples of biological macromolecules: Microarrays can also quantify the abundance.

4. One-of-a-kind foot Molecule of interest is identified by some unique feature. Cinderella is identified by her unique foot. The foot is the “target” to be sought. If her foot was common to all women, then would her foot be useful target? Unique molecular features (targets). –DNA or RNA  sequence of ACGT(U) –Proteins  AA, Epitopes –Lipids ? –Carbohydrates  branch structure

5. Need a perfect slipper Molecule of interest (target) must capture, or be captured by, a second molecule (probe). Many feet had to be evaluated by an easy test. The specific, not common, glass slipper was used as the test (probe). Unique molecular probes. –DNA or RNA  DNA or RNA (Oligo nt). –Proteins  Proteins (Antibodies) –Lipids ? –Carbohydrates ? My focus: DNA targets probed with complementary DNA

6. DNA Pairing Fundamentals Adenine (A) pairs with Thymine (T) Cytosine (C) pairs with Guanine (G) The two DNA strands are held together by _______ bonds “Complimentary Strands”

7. Base- pairing allows DNA:DNA or DNA:RNA

8. Example application Do Diabetic patients have lower glycogen synthase levels compared to healthy individuals? Analyze RNA, determine specific target –5’...UAUUAGCGCUCGAUCGCUUAGUACAGCGAGGAAAAGUCCGAUAGUAC...3’ Synthesize DNA probe – 3’ ATCATG 5’ Attach probe to a surface. –Nylon sheet –Plastic dish –Glass slide Prepare samples Diabetes 51:1913-1920, 2002 Gene Expression Profile in Skeletal Muscle of Type 2 Diabetes and the Effect of Insulin Treatment, Sreekumar, et al. Extract mRNA from skeletal muscle sample D+ D- Label all mRNA, expose to probes

9. Hybridization Notice all mRNA is labeled (florescence) Non-binding mRNA is washed away If surface “glows”, then target was captured by probe. What does it mean if no “glow” is detected? http://www.affymetrix.com

10. Example Results D- D+ Membrane with glycogen synthase probe attached Labeled mRNA* Wash * ** * * * * * * * * * ** * * * * * * * * * * * *

11. Red-Green http://www.unc.edu

12. Millions of copies per feature

13. Photolithography Affymetrix - Photolithography Nimblegen – microscopic independent mirrors to direct light.

14. Coordinates of fluorescence determines test results.

15. 500,000 Probe 16S array (DOE 16S Chip)

16. Rapid taxonomic classification of complex consortia of environmental rDNA using a microarray. What “bugs” are in my sample? Environmental Surveys Counter Bio-terrorism Bioremediation Clinical Investigations

17. Example Microorganisms C. immitis B. anthracis Plus thousands more.... Lung

18. Project Overview Goal –Create a single microarray capable of detecting and categorizing the bacteria in a complex sample. Approach –GeneChip targeted at 16S rDNA sequence variations to distinguish taxa.

19. The Ribosome rDNA rRNA (functional molecule) LSU SSU 16s or 18s

20. Foundations: –Maintain the largest 16S gene library (~83,000). –Cluster sequences into taxa (~10,000). –Create algorithm for picking probes for each taxa (~500,000).

21. Probe set: 02280401041000.2154 Desulfovibrio sp. str. DMB. Desulfovibrio sp. 'Bendigo A' Desulfovibrio vulgaris DSM 644 Regions unique to taxon Regions not unique to taxon Sequence discrepancies

22. General Protocol Air Soil Feces Blood Water rRNA gDNA Universal 16S rDNA PCR Contains probes adhered to glass surface in grid pattern. Run Video

23. C. jejuni probe sets 45 deg C48 deg C50 deg C 2280503040000.010d_st301522191927 2280503040000.010c_st301123032126 2280503040000.010b_st316623972548 2280503040000.010_st316223202291 mean:308823092223 standard deviation:8773263 coefficient of variation:0.03 0.12 Reproducibility  Probes for C. jejuni tiled in 4 areas

25. Counter Bio-Terrorism -Sampling the Air -Extracting DNA -Hybridization -PCR -Single Organism Detection -Detection Arrays for Multiple Organisms

26. Traditional Detection Collect air sample Swab sample onto petri dish Wait 2 days to 4 weeks for organisms to grow –Isolate –Biochemical tests –Visual Inspection

27. PCR Polymerase Chain Reaction –Makes many DNA copies from few

28. Hybridization Occurs Between Complimentary Strands Separate when heated Join properly when cooled

29. Probes Search for Targets Probes

30. Probes Search for Targets

31. DNA Replication Foundations DNA Polymerase –enzyme which “xeroxes” a single strand in to a double strand –assembles dNTPs monomers into a polymeric strand –adds dNTPs to 3’ end of polymer Poly G A C G T T A A C C T G G AGA

32. An in vitro technique for creating many copies of a gene segment Components –polymerase –template DNA –dNTPs (individual A, C, G, or T) –Small probes called “primers” Poly G A C G T T A A C C T G G AGA Polymerase Chain Reaction (PCR) Let’s do it...

33. Polymerase Chain Reaction (PCR) A A AAAA G GGGG G T TTTTCCCCCCC TT T TT G GG G G A AA - 5’ 3’- Single stranded template to be “xeroxed” 95° Hot temperature ensures template is single stranded.

34. A T ACG A G GC T T A G CAA G 5’- - 3’ A A AAAA G GGGG G T TTTTCCCCCCC TT T TT G GG G G A AA - 5’ 3’- Primer designed by lab Polymerase Chain Reaction (PCR) 95°

35. A T ACG A G GC T T A G CAA G 5’ - - 3’ A A AAAA G GGGG G T TTTTCCCCCCC TT T TT G GG G G A AA - 5’ 3’ - 55° Polymerase Chain Reaction (PCR) Lowering temperature allows hydrogen bonding to form

36. A A TACG A G GCTTAGCA A G 5’ - A A AAA A G GGG G G T TT T T CCCCCC C TT T TT G GG G G A AA - 5’ 3’ - Poly G A C G T T A A C C T G G AGA - 3’ 72° Polymerase can act upon free 3’ end when it has bound to the template. Temperature raised to optimize polymerase activity Polymerase Chain Reaction (PCR)

37. C G C A A TACG A G GCTTAGCA A G 5’ - A A AAA A G GGG G G T TT T T CCCCCC C TT T TT G GG G G A AA - 5’ 3’ - A AT C A G C C T C T T T Poly G A C G T T A A C C T G G AGA - 3’ 72° Temperature raised to optimize polymerase activity Polymerase Chain Reaction (PCR) Polymerase can act upon free 3’ end when it has bound to the template.

38. career preparation Do a Senior Project that involves both CS and BIO students Find Mentor Interview, Interview, Interview (on campus, off-campus, maintain contacts) Learn HTML/Perl/Java/CGI

39. Attractive Perl Properties:  Forgiving syntax  Interpreted, not compiled  Platform independent  Text manipulation  Libraries, modules, etc.  Object oriented optional

40. Why Perl is the leading language of Bioinformatics? Perl easy to learn Perl is powerful Perl is free Large support group: www.bioPerl.org Interfaces easily to relational databases In fact, it has been claimed that Perl saved the Human Genome Project

41. Examples: Find all the genomic 20-mers in common between Vibrio cholera str.14 and Vibrio mimicus This could take a long time by hand. V.choler14...TTGTACACACCGCCCGTCACACCATGGGAGTGGNCTGCAAAAGA-GCAGGTAGTTTAACC... V.mimicus...TTGTACACACCGCCCGTCACACCATGGGAGTGGGCTGCAAAAGAAGCAGGTAGTTTAACC...

42. Probe Finding Project Given: –one microbial taxon Purpose: –Describe its taxonomic placement. –Find two interesting things about the organisms in that taxa. –Find a probe that is specific for a group of organisms. Method: –Obtain 16S Sequences. –Align them to each other (MSA) –Determine best target from a short list (provided). Verify that probe exists in all/most orgs of taxa Check for X-hybe (non-specificity) –Check w/in sub-division, not all sequences

43. Start Here

44. Answers (Targets) Oceanospirillum –TGCTACTTCGCCGGCGAGCGGCGGA Streptococcus –CTTGACATCCTTCTGACCGGCCTAG Rhodococcus –CGGGTCTCTGGGAAACAACTGACGC –TGGGAAACAACTGACGCTGAGGAAC Methanocorpusculum –TGGAGAATACTCCCGGGAAACTGGG Desulfovibrio –GCGTGAAAGGACTTCGGTCCGAGTA

45. Multi Microarray Analysis Track a bio-marker over many experiments. Download file –Fluorescence intensity for118 taxa reported for 5 experimental conditions, and a negative control. Find –Taxa with highest intensity overall. –Possible PCR contaminants –Taxa with greatest intensity fluctuation overall –Condition producing the brightest signal for Paracoccus yeeii?