1. DNA barcoding: a new diagnostic tool for rapid species recognition, identification, and discovery
Source: James Hanken
Museum of Comparative Zoology
Harvard University, USA

2. TAXONOMY
Taxonomy is the science of naming, describing and classifying organisms and includes all plants, animals and microorganisms of the world.
Unfortunately, taxonomic knowledge is far from complete. In the past years of research, taxonomists have named about 2 million species of animals, plants and micro-organisms, yet the total number of species is unknown and probably between 5 and 30 million.
SYSTEMATICS
The study of biodiversity and the relationships among living things, past and present

4. If the specimen to be identified is immature in its development
Classical taxonomy uses terminology that can act as a barrier to understanding and reduces the number of persons who are qualified to identify species and describe biodiversity
Leaves alternate proximally, opposite and ultimately decussate distally, 6–16 × 4–13 cm; petiole ca. as long as blade, winged, base clasping, basal lobes stipulate, growing as extensions of wings, less than
1 mm wide; blade 5–7-veined, ovate, glabrous, base typically sagittate, margins entire, apex acute to acuminate. Staminate inflorescences axillary, 1–2 per axil, paniculate, fasciculate; panicles bearing flowers singly,bracteolate, in a zigzag pattern along rachis, internodes less than 2 mm; rachis to 25 cm, secondary axes 1–3(–6), fasciculate, less than 3 cm, each subtended by deltate-ovate bracteole shorter than 1 mm. Pistillate inflorescences solitary, 4–8(–20)-flowered, 6–35 cm, internodes ca. 1 cm
The body form ranges from hemispherical (e.g., Cleidostethus) to elongate oval (e.g., Clypastraea) to latridiid-like (e.g., Foadia).  Corylophids are typically dull brown, but some species have contrasting yellowish-brown patches on the pronotum or elytra.  The integument is often densely punctured and may be glabrous or bear short, fine recumbent setae.  Most corylophid adults can be diagnosed using the following morphological features: Maxilla with single apical lobe; Mesotrochanter short and strongly oblique; Head usually covered by pronotum; Frontoclypeal suture absent; Antennae elongate with 3-segmented club; Procoxal cavities closed externally; Tarsal formula 4-4-4; Pygidium exposed
If the specimen to be identified is immature in its development
or damaged and incomplete, identification may be impossible.

5. Classical taxonomy DNA barcoding Complex and somewhat objective
Leaves alternate proximally, opposite and ultimately decussate distally, 6–16 × 4–13 cm; petiole ca. as long as blade, winged, base clasping, basal lobes stipulate, growing as extensions of wings, less than 1 mm wide; blade 5–7-veined, ovate, glabrous, base typically sagittate, margins entire, apex acute to acuminate. Staminate inflorescences axillary, 1–2 per axil, paniculate, fasciculate; panicles bearing flowers singly,bracteolate, in a zigzag pattern along rachis, internodes less than 2 mm; rachis to 25 cm, secondary axes 1–3(–6), fasciculate, less than 3 cm, each subtended by deltate-ovate bracteole shorter than 1 mm. Pistillate inflorescences solitary, 4–8(–20)-flowered, 6–35 cm, internodes ca. 1 cm
Complex and
somewhat objective
Simple (A,T,G, or C) and more
reliably objective
DNA barcoding
>Dioscorea alata (matK) gene, partial
ATTTAAATTATGTGTCAGATATATTAATACCCCATCCCATCCATCTGGAAATCCTGGTTCAAATACTTCAATGCTGGACTCAAGATGTTTCCTCTT
TGCATTTATTGCGATTCTTTCTCCACGAATATCATAATTCGAAT AGTTTCATTACTCCGAAAAAACCTATTTACGTGATTTCAATTTCAAAAGAAA
ATAAAAGATTTTTTCGAT TCCTATATAATTCTTATGTATTTGAATGTGAATTTGTATTAGTTTTTTTTCATAAGCAATCCTCTTATTT ACGATCAA
GGTCCTCTGGAGTCTTTCTTGAGCGAACACATTTCTATGGAAAAATGGGGCATTTTTTAGTAGTGTGTTGTAATTATTTTCAGAAGACCCAATG
GTTCTTCAAAGATCCTTTTCTGCATTATGTTCGATATC AAGGAAAAGCAATTCTGGTGTCAAAGGGAACTCGTCTTTTGATGAGGAAATGGAGA
TCTTACCTTGTCCATTTTTGGCAATATTATTTTCAATTTTGGTCTCATCCGCATAGGATTCATATAAACCAATTATCAAATTATTCCTTCTGTTTTC
TGGGTTATCTTTCAAATGTACTAATAAATTTTTCCGTGGTAAGGAGTCAAATGTTAGAAAATTCATTTGTAATAGATACTCTTACTAAGAAATT
TGATACCAGAGTTTCAGTTATTGCTCTTATTCG ATCATTGTCTAAAGCGAAATTTTGTACCGTATCCGGGCATCCTATTAGTAAGTCAATATGGA
CAAATTTC TCAGATTTGGATATTATTCATCGATTTGGTTGGATATGTAGAA

7. What is DNA barcoding?
Definition: Using a short DNA sequence that enables species identification or recognition in a particular domain of life (eucaryotes).
Focus to date—in animals—has been on a 658 base-pair (bp) fragment of the mitochondrial gene, cytochrome oxidase subunit I (COI).
The Barcode of Life Initiative (BOLI) would resolve barcodes for named species and use a barcoding approach to assess undescribed biological diversity.

8. Primer on DNA Barcoding
DNA barcoding is based on a simple, but powerful premise. It argues that
sequence diversity in short, standardized gene regions can provide a sophisticated
tool for both the identification of known species and the discovery of new ones.
DNA Barcoding uses the four alternate nucleotides at each position of the DNA
strand to generate genetic "barcodes" capable of telling species apart, in a manner
analogous to the Universal Product Code (UPC) used in the retail industry. The
system remains rooted in traditional taxonomy, but DNA provides an alternative
to morphology for diagnosing species and enables non-experts to objectively identify
species.

9. “the role of any molecular diagnostic is to aid research, not to serve as an end in itself. Barcoding … is independent of questions as to whether individual taxa are species, what species are (or should be), and where they fit in a unified tree of life…. Barcoding is not an end in itself, but will boost the rate of discovery. The unique contribution of DNA barcoding to … taxonomy and systematics is a compressed timeline for the exploration and analysis of biodiversity.”

10. What is DNA Barcoding?
All Kingdoms, All Species, One gene (or two or three genes?)
The purpose is identification … NOT phylogeny
In animals, the barcode gene is cytochrome oxidase 1 (CO1)
A single copy mitochondrial gene, AT rich
648 bp region is the core for animals
In plants, the barcode genes are matK and rbcL
Hollingsworth et al., 2009, PNAS 106: 12794–12797, 2009.
In fungi, the barcode gene has not been formalized
By default it is co1 until an alternative is accepted
Barcode

11. Strengths
Offers alternative taxonomic identification tool for situations in which morphology is inconclusive.
Focus on one or a small number of genes provides greater efficiency of effort.
Cost of DNA sequencing is dropping rapidly due to technical advances.
Potential capacity for high throughput and processing large numbers of samples.
Once reference database is established, can be applied by non-specialist.

12. It appeals to the biotech sector

13. Weaknesses
Assumes intraspecific variation is negligible, or at least lower than interspecific values.
No single gene will work for all taxa (e.g., COI is not appropriate for vascular plants, or even for some animals).
Single-gene approach is less precise than using multiple genes; may introduce unacceptable error.
Some of the most attractive aspects rely on future technology, e.g., handheld sequencer.

14. How Barcoding works
Organisms are sampled DNA is extracted “Barcode” amplified
ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTACTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG
Sequenced DNA is compared with species in a barcode database

15. Why are these three criteria important?
Choosing a DNA barcode
There are many criteria that go in to selecting an appropriate region that can serve as a DNA barcode.
Three of them include:
Universality
Robustness
Discrimination
Why are these three criteria important?

16. Universality
Since barcoding protocols (typically) amplify a region of DNA by PCR, you need primers that will amplify consistently.
Once you have a candidate locus (loci) that seem discriminatory, do these loci (possibly genes, but possibly non-coding DNA) exist in in virtually all of the species you wish to barcode?
Will you be able to find PCR primers that can amplify across many species, despite mismatches?

17. Robustness
Since barcoding protocols (typically) amplify a region of DNA by PCR, also need to select a locus that amplifies reliably, and sequences well.
PCR is very sensitive to the chemistry involved (types of enzymes, concentration of reagents, cycling parameters, etc.
The amplified PCR product must also be sequenced. Sanger sequencing is sensitive to highly repetitive DNA.

18. Discrimination
Barcoding regions must be different for each species. Ideally you are looking for a single DNA locus which differs in each species.
Oppositional Goals:
Each loci must be different for each species
Although loci must be different, they must be similar enough that
they can be amplified by PCR, aligned and compared

19. Fail: Sequence is completely conserved, good for PCR, but uninformative as barcode
Fail: Sequence shows no conservation, impossible for PCR, but good as barcode
Win: Sequence shows some (ideally ~70%) conservation, good for PCR, good as barcode

20. DNA Barcoding: Plants vs. Animals
Finding a DNA locus that possesses all of these
qualities (discrimination, universality, robustness)
was relatively easy in animals.
The animal barcode of choice
Is the mitochondrial gene
cytochrome c oxidase I (COI).

21. Based on recommendations by a barcoding consortium (Consortium for the Barcode of Life, plant working group) the chloroplast genes rbcL and matK come very close to being ideal candidates for universal plant barcodes.
Like any barcode loci that could be chosen, there is always a possibility of failure to make a reasonably definitive identification of a particular specimen.

22. Potential applications
1) Facilitating identification and recognition of named (described) species:
linking life history stages, genders;
differentiating cryptic species;
identifying gut contents;
human disease vectors;
agricultural pests;
biosecurity (?)
2) Surveying and inventorying biodiversity; e.g., flagging potentially new (undescribed) species.

23. Verification of food species
Consumer information: Analyzing contents of brands of hot dogs using DNA Fish Tale Has DNA Hook: students find bad labels (NYT 8/22/08)

24. Katie and Louisa 2 high school students
Analyzed fish DNA from grocery stores, fish markets, and restaurants

25. One-quarter of samples were mislabeled— all as more expensive or more desirable fish
Mislabeling in
6 of 10 grocery stores/fish markets
2 of 3 restaurants
FishBase: John Casselman
Range map: FishBase
Kate and Louisa found that one-quarter of fish items sold in stores in our neighborhood were mislabeled, always as more expensive or more desirable fish. This appeared to be widespread: mislabeled items were obtained from 6 of 10 grocery stores and 2 of 3 restaurants.

26. Fish sold as white tuna was Mozambique tilapia 7 of 9 samples of red snapper were mislabeled anything from Atlantic cod to Acadian redfish (an endangered species) Roe (caviar) labeled from flying fish was actually from smelt
Kate and Louisa found that one-quarter of fish items sold in stores in our neighborhood were mislabeled, always as more expensive or more desirable fish. This appeared to be widespread: mislabeled items were obtained from 6 of 10 grocery stores and 2 of 3 restaurants.

27. Future Norm? A taxonomic GPS Link to reference database
Usable by non- specialists.

28. What are the steps for DNA barcoding in the lab???
Check out this simulation from the DNA Learning Center: