1. DNA – life’s code
DNA = Molecule that makes up genes and determines the traits of all living things

2. Griffith’s Mouse Experiment
Fredrick Griffith

3. Frederick Griffith
Mixing together different strains of bacteria allowed substances (DNA) to
mix.
Something has to exist to transfer \
information from one bacteria
type to a different type.
That something is DNA!!

5. Purified different bacteria parts and injected these into mice.
Avery, MacLeod, and McCarty
Purified different bacteria parts and injected these into mice.
Determined that DNA was the genetic material responsible for Griffith’s results (not RNA).
Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings.

6. Hershey-Chase Experiment
Section 12-1
Virus injects DNA not proteins.
DNA is the genetic information NOT proteins.
Bacteriophage with phosphorus-32 in DNA
Phage infects bacterium
Radioactivity inside bacterium
Bacteriophage with sulfur-35 in protein coat
Phage infects bacterium
No radioactivity
inside bacterium

7. Hershey-Chase Bacteriophage Experiment - 1953
Bacteriophage = Virus that attacks bacteria and replicates by invading a living cell and using the cell’s molecular machinery.
Structure of T2 phage
Bacteriophages
are composed of
DNA & protein

8. Life cycle of virulent T2 phage:

9. Rosalind Franklin Thought DNA had a double helix shape/structure.
RNA helps to make proteins

10. Structure of DNA
James D. Watson/Francis H. Crick 1953 proposed the Double Helix Model based on two sources of information:
1. Photograph of Franklin’s work.
2. Learning Base Pairing Rules.
Conclusion-DNA is a helical structure

11. Importance of DNA Controls by: producing proteins
Proteins are important because
All structures are made of protein
Skin
Muscles
Bones
All actions depend on enzymes (special kind of protein)
Eating
Running
Thinking
All life activities
DNA contains the complete instructions for making all proteins

12. DNA Structure Stands for deoxyribonucleic acid
Double helix = twisted ladder
linked nucleotides

13. DNA Structure - nucleotide
Made of 3 things:
Deoxyribose (sugar)
Phosphate Group
Nitrogen bases

14. DNA Structure – nitrogen bases
Four types of Nitrogen Bases:
Adenine
Cytosine
Guanine
Thymine
A nucleotide is named for the nitrogen base it contains

15. Linking Nucleotides
Nucleotides join together to make DNA – complementary base pairing
Adenine fits with Thymine
A – T
Cytosine fits with Guanine
C – G

16. Base Pairing
Base Pairing = nucleotides in a base pair are complementary which means their shape allows them to bond together with hydrogen bonds.
Adenine (A) bonds with Thymine (T)
Cytosine (C) bonds with Guanine (G)

17. Base Pairs
Base Pairs consist of a Purine and a Pyrimidine bonded together.
Purine = 2 carbon rings
Adenine (A)
Guanine (G)
Pyrimidine = 1 carbon ring
Thymine (T)
Cytosine (C )

18. Interest Grabber A Perfect Copy
When a cell divides, each daughter cell receives a complete set of chromosomes. This means that each new cell has a complete set of the DNA code. Before a cell can divide, the DNA must be copied so that there are two sets ready to be distributed to the new cells.
Go to Section:

19. Interest Grabber continued
1. On a sheet of paper, draw a curving or zig-zagging line that divides the paper into two halves. Vary the bends in the line as you draw it. Without tracing, copy the line on a second sheet of paper.
2. Hold the papers side by side, and compare the lines. Do they look the same?
3. Now, stack the papers, one on top of the other, and hold the papers up to the light. Are the lines the same?
4. How could you use the original paper to draw exact copies of the line without tracing it?
5. Why is it important that the copies of DNA that are given to new daughter cells be exact copies of the original?
Go to Section:

20. DNA Replication
DNA replication is the process of producing two identical replicas from one original DNA molecule.
All living things replicate their DNA
Happens in Interphase before Mitosis and Meiosis

21. DNA Replication Making a chromosome copy
One strand  two identical strands
Each new double helix is consisted of one old and one new chain.
This is what we call semiconservative replication.

22. DNA Polymerase
DNA Polymerase: In charge of copying DNA and finding matching bases to pair with the original strand
DNA must be faithfully replicated…but mistakes occur
DNA polymerase (DNA pol) inserts the wrong nucleotide base in 1/10,000 bases
DNA pol has a proofreading capability and can correct errors

23. Steps of DNA Replication
1). Breaking of hydrogen bonds between bases of the two DNA strands.
2). DNA unwinds
The splitting happens in places of the chains which are rich in A-T.
Helicase is the enzyme that splits the two strands.
Creates a "Replication Fork".

24. Steps of Replication 3). DNA Polymerase binds to the starting site
4). DNA Polymerase can "read" the template and continuously adds complementary nucleotides
5). Elongation Process
6). DNA Polymerase reaches to an end of the strands and detaches .
7). Error Check: Enzymes remove the wrong nucleotides and the DNA Polymerase fills the gaps.

25. Figure 12–11 DNA Replication
Section 12-2
Original strand
DNA polymerase
New strand
Growth
DNA polymerase
Growth
Replication fork
Replication fork
Nitrogenous bases
New strand
Original strand
Go to Section:

26. Animation Links DNA replication

27. DNA Replication Review
The process of DNA Replication is NOT used to make proteins
Only used to make more DNA so cells can divide.

28. RNA vs. DNA Review
Similarities: DNA & RNA
Differences: DNA & RNA

29. Protein Synthesis = Make Proteins
DNA Replication is NOT part of protein synthesis
Two steps:
Transcription: taking your DNA (genes) and making it into messenger RNA (mRNA).
Translation: turning messenger RNA (mRNA) into proteins
proteins make up cells.

30. Protein Synthesis: Flow Chart
1. Transcription
2. Translation

31. 1. Transcription Takes place in the nucleus.
mRNA results from the process of transcription
Takes DNA and makes mRNA.
mRNA can leave the nucleus.

32. TRANSCRIPTION
ACGATACCCTGACGAGCGTTAGCTATCG
UGC
UAU
GGG
ACU

33. Major players in transcription
mRNA- type of RNA that encodes information for the synthesis of proteins and carries information to ribosome from the nucleus

34. Major players in transcription
RNA polymerase- complex enzymes with 2 functions:
Unwind DNA sequence
Produce mRNA transcript by stringing together the chain of RNA nucleotides

35. Transcription Steps 1. RNA polymerase bind to a DNA molecule.
2. The DNA is unwound to separate and expose the strand to be transcribed.
3. RNA Polymerase begins to synthesize a strand of RNA complementary to one side of the DNA strand, moving into the coding sequence portion of the gene being transcribed.
4. A RNA molecule is produced by DNA polymerase as it reads the DNA code.

36. Transcription
5). RNA polymerase encounters a particular DNA sequence, telling it to stop.
6). RNA polymerase disengages from the DNA and the RNA molecule is released for processing.
Adenine (DNA and RNA)
Cystosine (DNA and RNA)
Guanine(DNA and RNA)
Thymine (DNA only)
Uracil (RNA only)
DNA
RNA

37. mRNA Processing The newly made transcript is not functional mRNA
DNA sequence has coding regions (exons) and non-coding regions (introns)
Introns must be removed before the transcript is mRNA and can leave nucleus

38. Transcription http://www.youtube.com/watch?v=OtYz_3rkvPk
Section 12-3
Transcription Animation

39. Transcription is done…what now?
Now we have functional mRNA transcribed from the cell’s DNA.
mRNA leaves the nucleus.
Once in the cytoplasm, it finds a ribosome so that translation can begin.
Question:
We know how mRNA is made, but how do we “read” the code?

40. Translation
Second stage of protein production
mRNA is on a ribosome

41. Translation
tRNA brings amino acids to the ribosome

42. Translation Translation is the synthesis of a polypeptide (PROTEIN)
TRANSCRIPTION
TRANSLATION
DNA
mRNA
Ribosome
Polypeptide
Amino
acids
tRNA with
amino acid
attached
tRNA
Anticodon
Trp
Phe
Gly A G C U
Codons 5 3
Translation is the synthesis of a polypeptide (PROTEIN)
Translation involves
mRNA
Ribosomes - Ribosomal RNA
Transfer RNA
Genetic coding - codons

43. Reading the DNA code Every 3 DNA bases pairs with 3 mRNA bases
Every group of 3 mRNA bases encodes a single amino acid
Codon- coding triplet (3) of mRNA bases

44. tRNA Transfer RNA Bound to one amino acid on one end
Anticodon on the other end matches mRNA codon

45. tRNA Function
Amino acids must be in the correct order for the protein to function correctly
tRNA lines up amino acids using mRNA code

46. Translation 1. The ribosome binds to mRNA at a specific area.
2. The ribosome starts matching tRNA anticodon sequences to the mRNA codon sequence.
3. Each time a new tRNA comes into the ribosome, the amino acid that it was carrying gets added to the elongating polypeptide chain.

47. Translation mRNA : Nucleus Messenger RNA mRNA Lysine Phenylalanine
Messenger RNA is transcribed in the nucleus.
mRNA
Lysine
Phenylalanine
tRNA
Transfer RNA
The mRNA then enters the cytoplasm and attaches to a ribosome. Translation begins at AUG, the start codon. Each transfer RNA has an anticodon whose bases are complementary to a codon on the mRNA strand. The ribosome positions the start codon to attract its anticodon, which is part of the tRNA that binds methionine. The ribosome also binds the next codon and its anticodon.
Methionine
Ribosome
mRNA
Start codon :

48. Translation (continued)
The Polypeptide “Assembly Line”
The ribosome joins the two amino acids—methionine and phenylalanine—and breaks the bond between methionine and its tRNA. The tRNA floats away, allowing the ribosome to bind to another tRNA. The ribosome moves along the mRNA, binding new tRNA molecules and amino acids.
Growing polypeptide chain
Ribosome
tRNA
Lysine
tRNA
mRNA
Completing the Polypeptide
The process continues until the ribosome reaches one of the three stop codons. The result is a growing polypeptide chain.
mRNA
Translation direction
Ribosome

49. The Genetic Code
Section 12-3 :

50. Translation Translation Occurs in the cytoplasm Occurs on ribosomes
mRNA -> Protein
Translation

51. DNA Splits In nucleus “Unzipping”
Transcription
DNA Splits In nucleus “Unzipping”
Messenger RNA (mRNA) copies DNA and DNA reforms ladder
Translation
Travels to ribosome
Transfer RNA (tRNA) copy mRNA and make proteins

52. Transcription vs. Translation Review
Process by which genetic information encoded in DNA is copied onto messenger RNA
Occurs in the nucleus
DNA mRNA
Translation
Process by which information encoded in mRNA is used to assemble a protein at a ribosome
Occurs on a Ribosome
mRNA protein

53. Gene Mutations:
Section 12-4
Substitution
Insertion
Deletion
Point mutation- mutations that affect one nucleotide; generally change one amino acid in a protein (ex: substitution)
Less Severe
Frameshift mutations (Insertion and Deletion) cause much bigger changes since the sequence is read in 3 base codons, everything is now moved over one spot
More Severe Mutations
Can change the entire protein.
Go to Section:

54. Typical Gene Structure
Section 12-5
Promoter (RNA polymerase binding site)
Regulatory sites
DNA strand
Start transcription
Stop transcription
At first glance- a DNA sequence is a bunch of jumbled letters, but soon patterns emerge.
Some sequences serve as promoters: binding sites for RNA polymerase
Some sequences are stop and start signals for transcription
Regulatory Sites: places where other proteins, binding directly to the DNA at that site, can regulate transcription. These help determine if a gene will be turned on or off
A typical gene includes start and stop signals, with the nucleotides to be translated in between
Go to Section: