1. Protein Ligand Interaction: (DNA binding)1
Protein Ligand Interaction: (DNA binding)
Park, Jong Hwa
MRC-DUNN
Hills Road Cambridge
CB2 2XY
England
Bioinformatics in Biosophy
Next:
02/06/2001

2. What is protein Ligand interaction?
Broadly, ligand refers to any non-protein molecules in cells.
DNA and RNA are the most important apart from water and
lipid membrane in cells.
1. Water
2. Fat (lipid)
3. Nucleic Acids (DNA, RNA,..)
4. Sugar
5. Metal ions
6. Phosphate, Sulphur,
7. Various small molecules (NO, H2O2, Ca,,,,)
Ligand interaction can be both: (1) Intramolecular
(2) Intermolecular.
Ligand Interaction can be both (1) Long term
(2) Short term (substrate)

3. Protein function is often dependent on ligands
The function of all proteins is dependent upon them binding other molecules. In the case of enzymes, these molecules, or ligands, are then transformed chemically.
Many other proteins, however, bind ligands in order
to regulate gene expression or enzymic activity, or
to transport molecules around.

4. Most ligand binding proteins have just one binding site
Most ligand binding proteins have just one binding site per polypeptide chain.
If the protein has more than one, then a binding site per domain is usually seen.
(exceptions: bacteriochlorophyll protein which binds seven chlorophyll molecules in one beta-barrel structure)

5. Ligand Binding sites (active sites)
Ligand binding sites on proteins are usually depressions on the surface of the protein, with the size and shape dependent upon the nature of the ligand.
Very small ligands such as metal ions are frequently carried inside the protein.
Larger ligands are bound to larger depressions.
Interactions with othe proteins often occur via flat faces on the protein
Interactions with very large molecules such as DNA occur via protruberances of the protein.
Polymeric ligands such as polysaccharides tend to bind to clefts formed by a fold of the protein.

6. Basic binding mechanism
Complementarity between the ligand and the binding site.
Steric complementarity, i.e. the shape of the ligand is mirrored in the shape of the binding site.
Physicochemical complementarity

7. Chemical Binding types
The interactions found between a protein and its ligand are generally similar to those seen within the protein,
Hydrogen bonding,
van der Waals interactions,
hydrophobic interactions
electrostatic interactions.
Hydrogen bonding is particularly important in interactions between polar groups. Proteins frequently bind ligands via complex hydrogen-bonding networks, often involving bound water as an intermediate.

8. Methyl-alpha-mannoside by ConA
Network of hydrogen bonding

9. Induced fitting to Proteins
In some ligand-protein interactions binding induces conformational changes in the protein.
(1) can be relatively minor adjustments of the polypeptide chain
(2) can be significant changes in conformation.
These are usually in the form of movements of domains relative to each other, or movements in surface loops;
The structural core is not usually involved in these changes

10. Binding affinity
The free energy of interaction between a protein and its ligand can vary greatly.
Some affinities for ligands can be so high that dissociation never occurs, in this case the ligand would be considered as a permanently attached prosthetic group.
In other cases, the affinity is so low that it is of questionable biological relevance.
The binding affinity is measured by the association constant (dissociation) for the binding equilibrium.

11. Association constant

12. Free and found proteins
The ratio of free protein to ligand bound protein is directly proportional to the free ligand concentration.
The fraction of protein molecules with bound ligand is given by.

13. Ka and Kd
Ka has units of [concentration]-1 and is a direct measure of the affinity, the greater the value of Ka, the greater the affinity. It is often more useful to consider the reciprocal of the association constant, the dissociation constant Kd which has units of concentration.
At [ligand] below Kd there is litle binding and at [ligand] equal to Kd half of the binding sites are occupied.
[] the concentration of

14. The number of binding sites
The number of binding sites on a protein (n) and the value of Ka (or Kd) can be obtained experimentally by determining the dependence of binding on free ligand concentration.
A useful treatment for such data is to construct a Scatchard plot.
This plot gives values for n and Ka.

15. Allostery
Sometimes, binding of one ligand affects the binding of other ligands.
This phenomenon is known as allostery. Binding at one ligand binding site can affect binding at another site on a protein, either enhancing binding affinity of the second ligand or decreasing it.
If two identical ligands interact this way, the interaction is homotropic, if two different ligands interact this way it is heterotropic.

16. Independent and different ligand binding
Some proteins exhibit different, but indepedent, ligand binding sites with different affinities.
This situation results in a biphasic Scatchard plot.

17. The gradients of the linear regions of the curve give approximations of the values of Ka1 and Ka2 and the y intercept gives the value of Ka1 + Ka2. The x intercepts give the number of binding sites and the extrapolation of the steep part of the curve gives the number of high affinity binding sites.

18. + and - Cooperativity of binding
The binding of a ligand to one site can affect the binding of a second ligand to the protein.
If the second ligand binding has higher affinity this is said to represent positive cooperativity, if it decreases affinity, this is negative cooperativity.
Positive cooperativity produces a sigmoidal relationship between degree of binding and free-ligand concentration.

19. Hill plot
This behaviour results in a convex curve on a Scatchard plot. For this reason, another graphical treatment is needed. The usual treatment is the Hill plot.
The slope in the middle of the plot is the Hill coefficient which gives a quantitative measure of the degree of cooperativity.

20. DNA binding
DNA binding proteins are very important in biological systems.
Their function is to bind to specific sequences of DNA (operator regions) in order to regulate gene expression.
Manipulation of these protein-DNA interactions is a useful tool for the biotechnologist wishing to maximise synthesis of a genetically engineered product or to switch off synthesis of an undesired product.

21. DNA

22. Cro An examine the properties of DNA-binding proteins: Cro protein.
Cro is a repressor protein involved in the lysogenic cycle of bacteriophage 434 and was one of the earliest DNA-binding proteins to be crystallised.
The DNA sequences that are recognised by DNA-binding proteins are usually palindromic.

23. Palindromicity
Many DNA binding proteins have palindromic binding sites.
Why?

24. Why palindromicity Symmetry is found in Biology again again.
Protein is symmetric  DNA symmetry.
If the protein is not symmetric  let’s make a dimer.
The efficiency of symmetry  stability and less computation for finding optimal interaction.
Palindromicity finding algorithm is difficult to make.
Try to make a simple palindromicity detection program using Perl.

25. Proteins are Gay?
The proteins that bind DNA are frequently dimeric, allowing interactions between one protein chain and one end of the palindrome.
Homodimer and Heterodimer  reason.

26. Cro  HTH motif
The DNA-binding region in Cro is formed by two alpha-helices linked by a turn. This is a common DNA-binding motif known as the Helix-Turn-Helix motif.

27. Helices of HTH
One of these helices binds to the DNA sugar phosphate backbone while one of them interacts with the major groove of the DNA double helix.
This alpha-helix is responsible for the specific interactions between the protein and DNA and is known as the recognition helix.

28. Which side of DNA?
The dimeric structure of the protein allows interaction with DNA sequences one full turn apart along the DNA double helix.

29. DNA/RNA protein Interaction cases
DNA-protein complexes complexes (WWW, FTP) (May 30, 2001)
RNA-protein complexes complexes (WWW, FTP) (November 16, 2000)

30. Interaction types:
Double Stranded DNA
Double Stranded RNA
Single Stranded DNA
Single Stranded RNA
Small Nucleic Acids

31. Interaction Modes
Major grooves
Minor grooves

32. DNA protein interactions can be specific and non-specific
The specificity is from the base to amino acid side chain interaction.
AAAAAAGCATTGCTTATCAATTTGTTGCA TTTTTTCGTAACGAATAGTTAAACAACGT

33. Specificity of CRO
DNA-binding proteins recognise specific sequences of DNA.
They achieve this by hydrogen bonding involving the amino acid side chains projecting from the recognition helix into the major groove.
These residues bond with base pairs in the recognition sequence.

34. Peptide chain and phosphate group Interaction

35. Protein kinds by sec. Str. elements
HTH (helix turn helix)  most
Beta sheet (ribbon)  metJ, Rare
Zinc finger
Zipper
Irregular

36. Dpinteract database from Church lab
Helix-Turn-Helix Protein Families
alpA; araC; arsR; asnC birA cI; cro; crp
deoR; dtxR fis; fur gntR hipB
iclR lacI; lexA; luxR; lysR
marR; merR; modE; mor
ner; ntrC pin rpoD; rpoN
sorC tetR; trpR Unclassified HTH
Probe-Helix Protein Families
ompR toxR
Beta-Ribbon Protein Families
cspA ihf metJ; mnt traY
Zinc-Finger Protein Families
dksA
Other and Unclassified Protein Families
abrB; argR dps int hha; hns
intR dnaJ mod; mtlR
glpG bolA nagC papB; papI
rop; rtp tus Unknown protein; Unclassified

37. DB entries HTH Class ID hth.class AC DP00452
DE helix-turn-helix proteins
RM Medline MUID
RL Nature 353: (1991)
RT A structural taxonomy of DNA-binding domains
RA Harrison SC
XR Class: beta-ribbon
RM Medline MUID
RL Annu Rev Biochem 59: (1990)
RT DNA recognition by proteins with the helix-turn-helix motif.
RA Harrison SC; Aggarwal AK

38. Common features in TFs RM Medline MUID 93345467
RL EMBO J 8: (1993)
RE EMBO J 12: 4042 (1993) Erratum
RT Common features in DNA recognition helices of eukaryotic transcription factors
RA Suzuki M

39. Common features in DNA recognition helices of eukaryotic transcription factors.
Suzuki M.
MRC Laboratory of Molecular Biology, Cambridge, UK.
Eukaryotic transcription factors which use an alpha-helix for DNA recognition, including the leucine zipper and homoeo domain proteins, have common features in the amino acid sequence of the DNA recognition helix, and also in the way this helix interacts with DNA.
These factors all share a similar 12 residue segment in the DNA recognition helix, which is named the probe helix, since it covers all the pertinent interactions. Moreover, in all cases the interactions can be divided into two parts: the Arg/Lys residues at positions 7, 9, 11 and 12 in the C-terminal half of the segment contact phosphate groups, whereas the N-terminal half interacts with the DNA bases by using residues at positions 1, 4, 5 and 8. The residue occupying position 1 is the most important for sequence specific DNA recognition. Similar 12 residue sequences are found in the DNA binding domain of many transcription factors including those of the TEA family, the Myc type of bHLH family, the MADS family, the Ets family and the OmpR family.
These generalities show that it might be possible to find a stereochemical code which explains three-dimensional interactions between DNA and an alpha-helix of this type.

40. DNA binding site matrices
# hits %non- # hits %non-
> mean coding > 2SD coding
ada
araC
arcA
argR
argR
carP
coldbox
cpxR
crp
cspA
cynR
cysB
cytR
deoR
fadR
farR
fhlA
fis
flhCD
fnr
fruR
fur
galR
gcvA
glpR
hipB hu
iclR
ilvY
lacI
lexA
malT
marR
melR
metJ
metJ
metR
modE
nagC
narL
narP
ntrC
ompR
oxyR
pdhR
phoB
phoB
purR
rhaS
rpoD
rpoD
rpoD
rpoD
rpoD
rpoE
rpoH
rpoH
rpoN
rpoS
rpoS
soxS
torR
trpR
tus
tyrR

41. DNA binding site database.
Transfac  Binding sites DB
Transcription Factor Classification Last modified
1 Superclass: Basic Domains
1.1 Class: Leucine zipper factors (bZIP)
1.1.1 Family: AP-1(-like) components
Subfamily: Jun
XBP v-Jun c-Jun JunB JunD dJRA
Subfamily: Fos
v-Fos c-Fos FosB
FosB FosB2
Fra Fra-2

42. Protein kinds: functionally
Effectors: DNA-bending proteins - Integration host factor (with bound DNA), HU, TF1
TATA-box-binding proteins
Polymerases: DNA-Polymerase III (Escherichia coli, beta-Untereinheit) (i California Lutheran University)
T7 DNA replication complex (i California Lutheran University)
HIV reverse Transcriptase (i California Lutheran University)
Recombination:
Hin Recombinase (i California Lutheran University)
RecA (Escherichia coli) (i California Lutheran University)
Topoisomerase I (Escherichia coli) (i California Lutheran University)
HIV-1 Integrase (i California Lutheran University)
HhaI DNA methylase (i California Lutheran University

43. DNA bending by protein.
1ihf.pdb

44. 1wtu

45. 1hue

46. The regulation of transcription initiation in eukaryotes is most thoroughly investigated with genes translated by RNA polymerase II. The process starts by recognition of a stretch of DNA containing a TATA sequence by a general initiation factor TFII (A - J). This involves a TATA box binding protein, too. The ternary complex formed from DNA/TBP/TFII binds more factors as well as the polymerase and thus forms the preinitiation complex (PIC). TATA box binding proteins could be crystallized on their own or bound to DNA or even as ternary complex.

47. The TATA box binding protein (TBP2) from Arabidopsis thaliana has a form like a saddle. The folding topology is a symmetric alpha/beta structure containing two domains of amino acids. Additionally there is a N-terminal segment of 18 amino acids (only a few are visible because of their large flexibility)

49. E. coli DNA Polymerase III Beta Subunit The Sliding DNA Clamp

50. DNA  DNA pol3 Protein

51. T7 DNA replication complex
primer and template strands

52. Domains of T7 replication complex

53. Single Stranded RNA-Protein
In 1999, with the determination of four crystal structures of
protein complexes with extended single-stranded RNA
molecules.
These structures revealed wonderfully
satisfying patterns of the ability of proteins to accommodate
RNA bases, with the sugar-phosphate backbone often adopting
conformations that are different from the classical double helix.

54. Metal binding sites
Very many proteins bind metal ions, either for purposes of storage or as part of their biological function in the case of metalloenzymes.
Small ligands such as metal ions are usually bound inside the protein and are bound by chemical several groups in a cooperative manner.
Individual affinities for ions by individual chemical groups are generally very low and this cooperative binding provides for the required specificity.

55. Metal Binding sites
Metal ions tend to bind to chemical groups that they have some intrinsic affinity, for instance Zn++ to sulphur atoms of cysteine residues and to histidine imidazole nitrogen atoms.
Fe++ and Fe+++ bind to sulphur atoms of cysteine residues, copper ions bind to thiols and imidazoles,
Mg++ ions bind along with phosphates on ligands and Ca++ bind to oxygen atoms.

56. Metal binding sites exmaples
1) M is Fe (rubredoxin) or Zn (aspartate transcarbamoylase, structural ions in liver alcohol dehydrogenase
2) Carboxypeptidase A
3) Catalytic ion in liver alcohol dehydrogenase
4) Azurin and plastocyanin

57. Ca and EF hand motif
A particularly important metal ion in biological systems is Ca++.
It is an important secondary messenger involved in muscle contraction.
It controls release of hormones and neurotransmitters.
It is inlvolved in binding of carbohydrates by lectins.
Many Ca++ binding proteins have a common structural motif known as the EF hand. This motif is formed from two helices linked by a turn.

58. The famous EF hand Find EF hand motif in Pfam and Prosite.
Make an alignment and make a regular expression.

59. The famous Calmodulin
EF hands were called the E and F helices in the protein in which they were discovered.
The EF hand is exemplified by the Ca++ regulatory proteins calmodulin and troponin C.
These proteins have an EF hand at each end of a long alpha-helix.

60. Make a 3D comparison algorithm which can find other EF hands in PDB database.

61. EF hand
The regulatory EF hand proteins reversibly interact with other proteins dependant on the presence or absence of bound Ca++.
The shape of the EF hand is very different in these two states, the binding of Ca++ causing a conformational change.
Binding of the regulatory protein to other proteins appears to be dependent on the conformation of the EF hands, explaining how Ca++ concentration (and therefore binding) can regulate the activity of proteins.

62. Ca  Troponin C EF hand
The Ca++ ion is held in place in the loop region of the EF hand by interactions with seven oxygen atoms found in the side chains of aspartic acid, asparagine, glutamic acid, threonine and serine.

63. Metal binding

65. Protein Ligand Databases
ReLibase for free copy)
PDBFinder (

66. To Dos 1. Finding Ligands from PDB (relibase etc) and parsing
2. Classifying DNA binding proteins