Presentation is loading. Please wait.

Presentation is loading. Please wait.

From Gene to Protein How Genes Work

Published byCori Thompson Modified over 6 years ago

Similar presentations

Presentation on theme: "From Gene to Protein How Genes Work"— Presentation transcript:

1 From Gene to Protein How Genes Work

2 What do genes code for? How does DNA code for cells & bodies? DNA
how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

3 DNA gets all the glory, but proteins do all the work!
The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work! replication

4 Metabolism taught us about genes
Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4

5 one gene : one enzyme hypothesis
1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

6 Beadle & Tatum Wild-type Neurospora Minimal medium Select one of
the spores Grow on complete medium control Nucleic acid Choline Pyridoxine Riboflavin Arginine Minimal media supplemented only with… Thiamine Folic Niacin Inositol p-Amino benzoic acid Test on minimal medium to confirm presence of mutation Growth on complete X rays or ultraviolet light asexual spores create mutations positive control negative control mutation identified experimentals amino acid supplements

7 1 gene – 1 enzyme hypothesis
Beadle & Tatum Compared mutants of bread mold, Neurospora fungus created mutations by X-ray treatments X-rays break DNA inactivate a gene wild type grows on “minimal” media sugars + required precursor nutrient to synthesize essential amino acids mutants require added amino acids each type of mutant lacks a certain enzyme needed to produce a certain amino acid non-functional enzyme = broken gene

8 Where does that leave us?!
So… What is a gene? One gene – one enzyme but not all proteins are enzymes but all proteins are coded by genes One gene – one protein but many proteins are composed of several polypeptides but each polypeptide has its own gene One gene – one polypeptide but many genes only code for RNA One gene – one product but many genes code for more than one product … Where does that leave us?!

9 if you don’t know what a wabbit looks like.
Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 gene RNA It’s hard to hunt for wabbits, if you don’t know what a wabbit looks like. 1990s -- thought humans had 100,000 genes ,000 was considered a good estimate ,000 ,000 is our best estimate polypeptide 1 polypeptide 2 polypeptide 3 gene

10 DNA mRNA protein trait From gene to protein nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

11 from DNA nucleic acid language to RNA nucleic acid language
Transcription from DNA nucleic acid language to RNA nucleic acid language

12 DNA RNA RNA ribose sugar N-bases single stranded lots of RNAs
uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

13 Transcription Making mRNA transcribed DNA strand = template strand
untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

14 RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1
only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes

15 Which gene is read? Promoter region Enhancer region
binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH

16 Transcription Factors
Initiation complex transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA

17 Matching bases of DNA & RNA
Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T

18 Eukaryotic genes have junk!
Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

19 mRNA splicing Post-transcriptional processing
eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript eukaryotic RNA is about 10% of eukaryotic gene. intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

20 Discovery of exons/introns
1977 | 1993 Discovery of exons/introns Richard Roberts Philip Sharp Beta thalassemia is an inherited blood disorder that reduces the production of hemoglobin. Symptoms of beta thalassemia occur when not enough oxygen gets to various parts of the body due to low levels of hemoglobin and a shortage of red blood cells (anemia). Signs and symptoms of thalassemia major appear in the first 2 years of life. Infants have life-threatening anemia and become pale and listless. They also have a poor appetite, grow slowly, and may develop yellowing of the skin and whites of the eyes (jaundice). The spleen, liver, and heart may be enlarged, and bones may be deformed. Adolescents with thalassemia major may experience delayed puberty. Thalassemia is a quantitative problem of too few globins synthesized, whereas sickle-cell anemia is a qualitative problem of synthesis of an incorrectly functioning globin. adenovirus CSHL MIT common cold beta-thalassemia

21 Splicing must be accurate
No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

22 RNA splicing enzymes snRNPs Spliceosome several snRNPs
small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste gene snRNPs exon intron snRNA 5' 3' spliceosome exon excised intron 5' 3' lariat mature mRNA No, not smurfs! “snurps”

23 Starting to get hard to define a gene!
Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene!

24 More post-transcriptional processing
Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein eukaryotic RNA is about 10% of eukaryotic gene. A 3' poly-A tail mRNA 5' 5' cap 3' G P A’s

25 DNA mRNA protein trait From gene to protein nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

26 from nucleic acid language to amino acid language
Translation from nucleic acid language to amino acid language

27 How does mRNA code for proteins?
TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

28 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

29 WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT
Cracking the code Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Codons blocks of 3 nucleotides decoded into the sequence of amino acids

30 Cracking the code 1960 | 1968 Nirenberg & Matthaei
determined 1st codon–amino acid match UUU coded for phenylalanine created artificial poly(U) mRNA added mRNA to test tube of ribosomes, tRNA & amino acids mRNA synthesized single amino acid polypeptide chain phe–phe–phe–phe–phe–phe

31 Marshall Nirenberg 1960 | 1968 Har Khorana

32 mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

33 The code Code for ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

34 How are the codons matched to amino acids?
3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

35 DNA mRNA protein trait From gene to protein nucleus cytoplasm
aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

36 Transfer RNA structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

37 tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP  AMP bond is unstable so it can release amino acid at ribosome easily The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. Trp C=O Trp Trp C=O OH H2O OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

38 Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

39 Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site)
holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A

40 Building a polypeptide
1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

41 Elongation: growing a polypeptide

42 Termination: release polypeptide
Release factor “release protein” bonds to A site bonds water molecule to polypeptide chain Now what happens to the polypeptide?

43 start of a secretory pathway
Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting Signal peptide address label start of a secretory pathway

44 Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA
exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

45 Protein Synthesis in Prokaryotes
Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall

46 Prokaryote vs. Eukaryote genes
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

47 Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed

48 Translation: prokaryotes vs. eukaryotes
Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing

Download ppt "From Gene to Protein How Genes Work"

Similar presentations

From Gene to Protein How Genes Work

From Gene to Protein How Genes Work
WARMUP Give three differences and three similarities between DNA and RNA.

WARMUP Give three differences and three similarities between DNA and RNA.
DNA gets all the glory, but proteins do all the work!

DNA gets all the glory, but proteins do all the work!
Nucleic Acids Examples: Structure: RNA (ribonucleic acid)

Nucleic Acids Examples: Structure: RNA (ribonucleic acid)
Protein Synthesis Notes

Protein Synthesis Notes
From Gene to Protein.

From Gene to Protein.
Chapter 14. From Gene to Protein Biology 114.

Chapter 14. From Gene to Protein Biology 114.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
MCC BP Based on work by K. Foglia www.kimunity.com Chapter 17. From Gene to Protein.

MCC BP Based on work by K. Foglia Chapter 17. From Gene to Protein.
AP Biology Lecture #33 Translation.

AP Biology Lecture #33 Translation.
From Gene to Protein How Genes Work

From Gene to Protein How Genes Work
AP Biology Warmup 11/12 Differentiate a codon and an anitcodon. Which do you use to read the following chart?

AP Biology Warmup 11/12 Differentiate a codon and an anitcodon. Which do you use to read the following chart?
AP Details for Protein Synthesis 2014 From gene to protein.

AP Details for Protein Synthesis 2014 From gene to protein.
AP Biology 2005-2006 Chapter 17. From Gene to Protein.

AP Biology Chapter 17. From Gene to Protein.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
AP Biology 2007-2008 From Gene to Protein How Genes Work.

AP Biology From Gene to Protein How Genes Work.
AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.

AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies?  how are.

Similar presentations

Ads by Google