Download presentation
Presentation is loading. Please wait.
Published byAnastasia Warner Modified over 5 years ago
1
What do genes code for? How does DNA code for cells & bodies? DNA
how are cells and bodies made from the instructions in DNA DNA proteins cells bodies
2
transcription and translation
The “Central Dogma” Francis Crick 1956 Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA is the flash but protein is the cash! replication
3
Metabolism taught us about genes
Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non- functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E enzyme 1 enzyme 2 enzyme 3 enzyme 4
4
one gene : one enzyme hypothesis
Beadle & Tatum 1941 | 1958 one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"
5
RNA DNA RNA ribose sugar N-bases single stranded lots of RNAs
uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA RNA
6
Transcription Making mRNA transcribed DNA strand = template strand
untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand enzyme RNA polymerase coding strand 3′ A G C A T C G T 5′ A G A A A G T C T T C T C A T A C G DNA T 3′ C G T A A T 5′ G G C A U C G U T 3′ C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 5′→3′ 5′
7
RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1
only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes
8
Which gene is read? Promoter region Enhancer region
binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH
9
Transcription Factors
Initiation complex transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA
10
Matching bases of DNA & RNA
Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T
11
Eukaryotic genes have ‘junk’!
Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the ‘junk’ in between sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence
12
NOT ‘junk’ at all!
13
mRNA splicing Post-transcriptional processing
eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript eukaryotic RNA is about 10% of eukaryotic gene. intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA
14
Discovery of exons/introns
1977 | 1993 Richard Roberts Philip Sharp Beta thalassemia is an inherited blood disorder that reduces the production of hemoglobin. Symptoms of beta thalassemia occur when not enough oxygen gets to various parts of the body due to low levels of hemoglobin and a shortage of red blood cells (anemia). Signs and symptoms of thalassemia major appear in the first 2 years of life. Infants have life-threatening anemia and become pale and listless. They also have a poor appetite, grow slowly, and may develop yellowing of the skin and whites of the eyes (jaundice). The spleen, liver, and heart may be enlarged, and bones may be deformed. Adolescents with thalassemia major may experience delayed puberty. Thalassemia is a quantitative problem of too few globins synthesized, whereas sickle-cell anemia is a qualitative problem of synthesis of an incorrectly functioning globin. adenovirus CSHL MIT common cold beta-thalassemia
15
Splicing must be accurate
No room for mistakes! a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|
16
Starting to get hard to define a gene!
Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons Starting to get hard to define a gene!
17
mRNA codes for proteins in triplets
TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein
18
The code Code for ALL life!
strongest support for a common origin for all life Code is redundant not ambiguous several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG A good reference to read:
19
How are the codons matched to amino acids?
3′ 5′ DNA TACGCACATTTACGTACGCGG 5′ 3′ mRNA AUGCGUGUAAAUGCAUGCGCC codon 3′ 5′ UAC Met GCA Arg tRNA CAU Val anti-codon amino acid
20
Transfer RNA structure
“Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3′ end
21
tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP → AMP bond is unstable so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O OH H2O The tRNA-amino acid bond is unstable. This makes it easy for the tRNA to later give up the amino acid to a growing polypeptide chain in a ribosome. OH O C=O O activating enzyme tRNATrp A C C U G G mRNA anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
22
Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon
organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A
23
Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site)
holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A
24
start of a secretory pathway
Protein targeting Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Signal peptide address label start of a secretory pathway
25
Can you tell the story? 3' 5' E P A
26
The Transcriptional unit (gene?)
enhancer 1000+b translation start translation stop exons 20-30b transcriptional unit (gene) RNA polymerase 3' TAC ACT 5' TATA DNA transcription start UTR introns transcription stop UTR promoter DNA pre-mRNA 5' 3' mature mRNA 5' 3' GTP AAAAAAAA
27
Protein Synthesis in Prokaryotes
Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall
28
Prokaryote vs. Eukaryote genes
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons Walter Gilbert hypothesis: Maybe exons are functional units and introns make it easier for them to recombine, so as to produce new proteins with new properties through new combinations of domains. Introns give a large area for cutting genes and joining together the pieces without damaging the coding region of the gene…. patching genes together does not have to be so precise. intron = noncoding (inbetween) sequence eukaryotic DNA introns come out! exon = coding (expressed) sequence
29
Translation in Prokaryotes
Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed
30
Translation: prokaryotes vs. eukaryotes
Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing
31
Mutations
32
When do mutations affect the next generation?
Point mutations single base change silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon When do mutations affect the next generation?
33
Point mutation lead to Sickle cell anemia
What kind of mutation? Missense!
34
Mutations Frameshift shift in the reading frame
changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?
36
What’s the value of mutations?
37
What color would a smurf turn if he held his breath?
Any Questions?? What color would a smurf turn if he held his breath?
38
Review Questions
39
1. If proteins were composed of only 12 different kinds of amino acids, what would be the small-est possible codon size in a genetic system with four different nucleotides? 1 2 3 4 12 Answer: b Source: Barstow - Test Bank for Biology, Seventh Edition, Question #9
40
2. A portion of the genetic code is UUU = phenylalanine, GCC = alanine, AAA = lysine, and CCC = proline. Assume the correct code places the amino acids phenylalanine, alanine, and lysine in a protein (in that order). Which of the following DNA sequences would substitute proline for alanine? AAA-CGG-TTA AAT-CGG-TTT AAA-CCG-TTT AAA-GGG-TTT AAA-CCC-TTT Answer: d Source: Barstow - Test Bank for Biology, Seventh Edition, Question #20
41
3. What is the relationship among DNA, a gene, and a chromosome?
A chromosome contains hundreds of genes, which are composed of protein. A chromosome contains hundreds of genes, which are composed of DNA. A gene contains hundreds of chromosomes, which are composed of protein. A gene is composed of DNA, but there is no relationship to a chromosome. A gene contains hundreds of chromosomes, which are composed of DNA. Answer: b Source: Barstow - Test Bank for Biology, Seventh Edition, Question #75
42
4. A particular triplet of bases in the coding sequence of DNA is AAA
4. A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that binds the mRNA codon is TTT. UUA. UUU. AAA. either UAA or TAA, depending on wobble in the first base. Answer: d Source: Barstow - Test Bank for Biology, Seventh Edition, Question #39
43
The dipeptide that will form will be
5. A part of an mRNA molecule with the following sequence is being read by a ribosome: 5' CCG-ACG 3' (mRNA). The following activated transfer RNA molecules are available. Two of them can correctly match the mRNA so that a dipeptide can form. tRNA Anticodon Amino Acid GGC Proline CGU Alanine UGC Threonine CCG Glycine ACG Cysteine CGG The dipeptide that will form will be cysteine-alanine. proline-threonine. glycine-cysteine. alanine-alanine. threonine-glycine. Answer: b Source: Barstow - Test Bank for Biology, Seventh Edition, Question #42
44
6. This figure represents tRNA that recognizes and binds a particular amino acid (in this instance, phenylalanine). Which of the following triplets of bases on the mRNA strand codes for this amino acid? UGG GUG GUA UUC CAU Answer: d Source: Barstow - Test Bank for Biology, Seventh Edition, Question #44
45
7. How is the template strand for a particular gene determined?
It is the DNA strand that runs from the 5' → 3' direction. It is the DNA strand that runs from the 3' → 5' direction. It depends on the orientation of RNA polymerase, whose position is determined by particular sequences of nucleotides within the promoter. It doesn’t matter which strand is the template because they are complementary and will produce the same mRNA. The template strand always contains the TATA box. Answer: c Source: Taylor - Student Study Guide for Biology, Seventh Edition, Test Your Knowledge Question #5
46
8. A biologist inserts a gene from a human liver cell into the chromosome of a bacterium. The bacterium then transcribes this gene into mRNA and translates the mRNA into protein. The protein produced is useless. The biologist extracts the protein and mature mRNA that codes for it. When analyzed you would expect which of the following results? * the protein and the mature mRNA are longer than in human cells the protein and mature mRNA are shorter than expected the protein is longer and the mRNA is shorter than expected the protein is shorter and the mRNA is longer than expected Answer: a Source: Campbell/Reece - Biology, Seventh Edition, EOC Process of Science Question Discussion Notes for the Instructor There are several questions which can be asked to guide the discussion of this question, including: What are the differences between the way the genetic information in prokaryotes and eukaryotes is packaged? How do transcription and translation differ in prokaryotes and eukaryotes? Using these questions as an outline, discussion of the choices might look like this: Choice A, correct Choice B, eukaryotes contain introns that are normally removed after transcription. In bacteria these introns would not be removed and then subsequently would be translated Choice C, the protein would not be expected to be longer if the mRNA is shorter Choice D, while it is possible for the protein to be shorter, owing to a termination sequence being found in what was an intron, this is unlikely.
47
9. If the structure of a TV show is analogous to the structure of a gene, then the introns of a gene would be analogous to the opening theme music. the segments of the show. the commercials between segments of the show. the commercials between shows. the closing credits. * Answer: c Source: Barstow - Test Bank for Biology, Seventh Edition, Question #41
48
10. Each of the following is a modification of the sentence THECATATETHERAT. A. THERATATETHECAT B. THETACATETHERAT C. THECATARETHERAT D. THECATATTHERAT E. CATATETHERAT Which of the above is analogous to a frameshift mutation? A B C D E Answer: d Source: Barstow - Test Bank for Biology, Seventh Edition, Question #68
49
11. Each of the following is a modification of the sentence THECATATETHERAT. A. THERATATETHECAT B. THETACATETHERAT C. THECATARETHERAT D. THECATATTHERAT E. CATATETHERAT Which of the above is analogous to a single substitution mutation? A B C D E Answer: c Source: Barstow - Test Bank for Biology, Seventh Edition, Question #69
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.