1. Biotechnology
Pre-AP Biology

2. DNA technology has many useful applications
The Human Genome Project
The production of vaccines, cancer drugs, and pesticides
Engineered bacteria that can clean up toxic wastes
Copyright © 2003 Pearson Education, Inc. publishing Benjamin Cummings

3. DNA and Crime Scene Investigations
DNA and Crime Scene Investigations
Many violent crimes go unsolved
For lack of enough evidence
If biological fluids are left at a crime scene
DNA can be isolated from them

4. DNA fingerprinting is a set of laboratory procedures
DNA fingerprinting is a set of laboratory procedures
That determines with near certainty whether two samples of DNA are from the same individual
That has provided a powerful tool for crime scene investigators
Investigator at one
of the crime scenes
(above), Narborough,
England (left)

5. BACTERIAL PLASMIDS AND GENE CLONING
Plasmids are used to customize bacteria: An overview
Gene cloning is one application of DNA technology
Methods for studying and manipulating genetic material

6. The Bacterial Chromosome
One double-stranded, circular molecule of DNA
Located in nucleoid region, so transcription and translation can occur simultaneously
Many also contain extrachromosomal DNA in plasmids

7. Binary Fission

8. Plasmids Short, circular DNA molecules outside the chromosome
Carry genes that are beneficial but not essential
Replicate independently of chromosome
en.wikipedia.org/?title=Plasmid

9. R Plasmids Contain genes that confer antibiotic resistance
Medical consequences: resistant strains of pathogens due to overuse of antibiotics

10. Bacteria as Tools Bacterial Transformation—
Uptake of DNA from the fluid surrounding the cell
Causes genetic recombination

11. Transformation
Biotech companies use this technique to artificially introduce foreign genes into bacterial genomes (human insulin, human growth hormone)

12. Researchers can insert desired genes into plasmids, creating recombinant DNA
And insert those plasmids into bacteria (transformation)
Figure 12.1

13. Bacterial clone carrying many copies of the human gene1
Isolate DNA from two sources
Human cell
E. coli
If the recombinant bacteria multiply into a clone
The foreign genes are also copied 2
Cut both DNAs with the same restriction
enzyme
Plasmid
DNA
Gene V
Sticky ends 3
Mix the DNAs; they join by base-pairing 4
Add DNA ligase to bond the DNA covalently
Recombinant DNA plasmid
Gene V 5
Put plasmid into bacterium by transformation 6
Clone the bacterium
Bacterial clone carrying many copies of the human gene

14. Restriction Enzymes Used to “cut and paste” DNA
Used to “cut and paste” DNA
The tools used to make recombinant DNA are
Restriction enzymes, which cut DNA at specific sequences
DNA ligase, which “pastes” DNA fragments together

16. Genes can be cloned in recombinant plasmids: A closer look
Bacteria take the recombinant plasmids from their surroundings
And reproduce, thereby cloning the plasmids and the genes they carry

17. Cloned genes can be stored in genomic libraries
Genomic libraries, sets of DNA fragments containing all of an organism’s genes
Can be constructed and stored in cloned bacterial plasmids or phages (viruses)
Figure 12.4

18. Transduction
The process by which any bacterial gene may be transferred to another bacterium via a bacteriophage (virus)

19. Nucleic acid probes
A short, single-stranded molecule of radioactively labeled or fluorescently labeled DNA or RNA
Can tag a desired gene in a library

20. CONNECTION
Recombinant cells and organisms can mass-produce gene products
Applications of gene cloning include
The mass production of gene products for medical and other uses
Table 12.6

21. Genetically modified organisms are transforming agriculture
New genetic varieties of animals and plants are being produced
A plant with a new trait can be created using the Ti plasmid

22. Biotech companies can artificially induce transformation of bacteria

23. “Golden rice” has been genetically modified to contain beta-carotene
This rice could help prevent vitamin A deficiency
Figure 12.18B

24. Drought resistant corn
Flavr Savr Tomato (CalGene)

25. Transgenic organisms
Are those that have had genes from other organisms inserted into their genomes
Different organisms, including bacteria, yeast, and mammals
Can be used for this purpose
Figure 12.6
These sheep carry a gene for a human blood protein that is a potential treatment for cystic fibrosis

26. CONNECTION DNA technology is changing the pharmaceutical industry
DNA technology is changing the pharmaceutical industry
DNA technology
Is widely used to produce medicines and to diagnose diseases

27. DNA technology is changing the pharmaceutical industry and medicine
Hormones, cancer-fighting drugs, and new vaccines are being produced using DNA technology
This lab equipment is used to produce a vaccine against hepatitis B
Figure 12.17

28. Therapeutic hormones
In 1982, humulin, human insulin produced by bacteria
Became the first recombinant drug approved by the Food and Drug Administration
Figure 12.7A

29. Diagnosis and Treatment of Disease
Diagnosis and Treatment of Disease
DNA technology
Is being used increasingly in disease diagnosis
Vaccines
Is also helping medical researchers develop vaccines
Figure 12.7B

30. DNA Fingerprinting
A method of developing a person’s DNA “profile,” similar to a fingerprint.
Pioneered in England in 1984 by Dr. Alec Jeffreys
Dr. Alec Jeffreys

31. First Forensic Use
First used by law enforcement in England in the mid-1980’s.
DNA evidence exonerated one man, and convicted another.
Described in The Blooding, by Joseph Wambaugh

32. How does it work? 99.9% of your DNA is the same as everyone else’s.
The 0.1% that differs are a combination of:
Gene differences (Differences in the genes themselves)
Differences in “polymorphic regions” between the genes on the DNA.

33. How does it work?
Certain points between the genes on the DNA have repeating base sequences.
For example: ATTACGCGCGCGCGCGCGCTAGC
These are called short tandem repeats (STRs for short)

34. How does it work?
Everyone has STRs at the same place in their DNA, but they are different lengths for different people.
For example: Person 1: ATTACGCGCGCGCGCGCGTAGC (7 repeats) Person 2: ATTACGCGCGCGCGTAGC (5 repeats)

35. To Make a DNA Fingerprint…
First, we use restriction enzymes to chop the DNA up into millions of fragments of various lengths.
Some of the fragments contain STRs; some do not. The ones that do are different lengths for different people.

36. Restriction Fragment Length Polymorphisms (RFLPs)
Polymorphisms are slight differences in DNA sequences as seen in individuals of the same species

37. To Make a DNA Fingerprint…
Next, we use gel electrophoresis to sort the DNA fragments by size.

38. Gel Electrophoresis
Method for sorting proteins or nucleic acids on the basis of their electric charge and size

39. Gel Electrophoresis
Electrical current carries negatively-charged DNA through gel towards positive electrode
Agarose gel sieves DNA fragments according to size
Small fragments move farther than large fragments

40. Gel Electrophoresis

41. To Make a DNA Fingerprint…
Figure 12.11C
Restriction fragment preparation 1
Restriction fragments
Gel electrophoresis 2
Blotting 3
Filter paper
Probe
Radioactive probe 4
Detection of radioactivity (autoradiography) 5
Film
To Make a DNA Fingerprint…
Finally, a radioactive probe attaches to our STRs. Only the fragments with our STRs will show up on the gel.

42. To Make a DNA Fingerprint…
Since STRS are different lengths in different people, this creates a DNA Fingerprint.

43. Two uses for DNA Fingerprints...
Forensics DNA taken from crime scenes (blood, semen, hair, etc.) can be compared to the DNA of suspects. Real-life CSI!

44. Two uses for DNA Fingerprints...
Forensics This is an example of a gel that might be used to convict a rape suspect. Compare the “Sperm DNA” to the “Suspect DNA.” Which suspect committed the rape?

45. Two uses for DNA Fingerprints...
Paternity Testing Since all of our DNA markers came from either mommy or daddy, we can use DNA fingerprints to determine whether a child and alleged father are related…just like on Maury Povich!

46. Two uses for DNA Fingerprints...
Look at the two “Child” markers on this gel. Can they both be matched up to either the mother or the “alleged father?”
Yes. This is a “positive” test for paternity.

47. Two uses for DNA Fingerprints...
How about this gel? Do both of the child’s markers match either the mother or the “alleged father.”
No! The “alleged father” is not this child’s biological parent.

48. Interpreting DNA Fingerprints
Which child is not related to the mother?
Son 2
Which children are not related to the father?
Daughter 2 and Son 2

49. Interpreting DNA Fingerprints
A blood stain was found at a murder scene. The blood belongs to which of the seven possible suspects?
Suspect 3

50. Interpreting DNA Fingerprints
Who committed this sexual assault?
Suspect 1

51. Interpreting DNA Fingerprints
These DNA fingerprints are from a mother, a child, and two possible biological fathers. Which one is the daddy?
2nd alleged father

52. Interpreting DNA Fingerprints
Mother, father, and four children. Which child is from a different father?
Child 2

53. The Polymerase Chain Reaction (PCR)
The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA
A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules

54. Polymerase Chain Reaction (PCR)
Quick method of cloning DNA in vitro (without using cells)
Can be used to increase small amounts of DNA for analysis

55. GENOMICS CONNECTION
The Human Genome Project is an ambitious application of DNA technology
The Human Genome Project, begun in 1990 and now largely completed, involved
Genetic and physical mapping of chromosomes, followed by DNA sequencing
Figure 12.15

56. CONNECTION The science of genomics compares whole genomes
CONNECTION
The science of genomics compares whole genomes
The sequencing of many prokaryotic and eukaryotic genomes
Has produced data for genomics, the study of whole genomes

57. Besides being interesting themselves
Besides being interesting themselves
Nonhuman genomes can be compared with the human genome
Table 12.17

58. Proteomics
The study of the full sets of proteins produced by organisms
Biotechnology Explorer™
Protein Fingerprinting
Instruction Manual

59. Biotechnology Explorer™
Protein Fingerprinting
Instruction Manual

60. Gene therapy may someday help treat a variety of diseases
Cloned gene (normal allele)
Techniques for manipulating DNA have potential for treating disease by altering an afflicted individual’s genes
Is the alteration of an afflicted individual’s genes
Progress is slow, however
There are also ethical questions related to gene therapy 1
Insert normal gene into virus
Viral nucleic acid
Retrovirus 2
Infect bone marrow cell with virus 3
Viral DNA inserts into chromosome
Bone marrow cell from patient
Bone
marrow
Inject cells into patient 4
Figure 12.19

61. DNA technology raises important ethical questions
Our new genetic knowledge will affect our lives in many ways
The deciphering of the human genome, in particular, raises profound ethical issues
Many scientists have counseled that we must use the information wisely
Figure 12.21A-C

62. Could GM organisms harm human health or the environment?
Genetic engineering involves some risks
Possible ecological damage from pollen transfer between GM and wild crops
Pollen from a transgenic variety of corn that contains a pesticide may stunt or kill monarch caterpillars
Figure 12.20A, B

63. Acknowledgements
BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2003. These images have been produced from the originals by permission of the publisher. These illustrations may not be reproduced in any format for any purpose without express written permission from the publisher.
Unless otherwise noted, illustrations are credited to Pearson Education which have been borrowed from BIOLOGY: CONCEPTS AND CONNECTIONS 4th Edition, by Campbell, Reece, Mitchell, and Taylor, ©2011. These images have been produced from the originals by permission of the publisher. These illustrations may not be reproduced in any format for any purpose without express written permission from the publisher.