Exome sequening: the principle

Exome sequening: the principle
Graduate School. Bioinformatics Sequence Analysis Prof. dr. Antoine van Kampen Bioinformatics Laboratory Academic Medical Center

Aims Understand basic principles of exome sequencing
Details will be explained in another lecture

From health to disease Disease DNA mutation Change in protein function
(How) can we identify the disease causing mutation?

Where is the mutation???

Exome sequencing Identification of gene variants that cause rare Mendelian disorders
Sarah Ng et al (2009) Targeted capture and massively parallel sequencing of 12 human exomes. Nature, 461(7261), (Freeman-Sheldon syndrome) Ng SB, Buckingham KJ, Lee C, Bigham AW, Tabor HK, Dent KM, Huff CD, Shannon PT, Jabs EW, Nickerson DA, Shendure J, Bamshad MJ. (2010) Exome sequencing identifies the cause of a mendelian disorder. Nat Genet., 42(1), 30. (Miller Syndrome)

Exome sequencing Identification of gene variants in protein coding regions that cause rare disorders What is a gene variant? What is a protein coding region? What is a rare disorder? (~1 in 2000 people) Why is this so difficult? In the United States, the Rare Diseases Act of 2002 defines rare disease strictly according to prevalence, specifically "any disease or condition that affects less than 200,000 persons in the United States," or about 1 in 1,500 people. This definition is essentially like that of the Orphan Drug Act of 1983, a federal law that was written to encourage research into rare diseases and possible cures. In Japan, the legal definition of a rare disease is one that affects fewer than 50,000 patients in Japan, or about 1 in 2,500 people. However, the European Commission on Public Health defines rare diseases as "life-threatening or chronically debilitating diseases which are of such low prevalence that special combined efforts are needed to address them." The term low prevalence is later defined as generally meaning fewer than 1 in 2,000 people. Diseases that are statistically rare, but not also life-threatening, chronically debilitating, or inadequately treated, are excluded from their definition. The definitions used in the medical literature and by national health plans are similarly divided, with definitions ranging from 1/1,000 to 1/200,000.

What is an exome? The exome is the part of the genome formed by exons

Gene variant Single Nucleotide Polymorphism (SNP): point mutation that has persisted in the population You often see: MUTATION : <1% of the total population SNP : >1% of the total population Allele: version of a gene at a given locus (e.g., SNPs) SNP / mutation == gene variant == gene with different allele Indel: small insertion or deletion

Let's do a game

Patients Rare disorder
Assume that disorder is caused by mutation in exome What procedure would you follow to find this mutation?

Overall principle Patients DNA Exons Sequences Clinic Laboratory
Acquire DNA DNA Exon capture Laboratory Exons Sequencing Sequences

(1) What is exon capture? A procedure to remove the exons from the DNA
A procedure to remove the introns and intergenic regions from the DNA The sequencing of exons The construction of microarrays that contain probes corresponding to exons

(2) Why do we need an exon capture?
It is not yet possible to sequence introns We have to do less sequencing The full DNA sequence is too complex to analyze Introns do not contain mutations

(3) What is the result of NGS in exome sequencing?
The DNA sequence of the patient A list of Single Nucleotide Polymorphisms Millions of sequence reads The mutation that causes the disease

Overall principle Patients DNA Exons Sequences Clinic Laboratory
Acquire DNA DNA Exon capture Laboratory Exons Sequencing Sequences RESULT: millions of sequence reads representing exons. What is the next step?

Overall principle Patients DNA Public database Exons Sequences
Clinic Obtain DNA DNA Exon capture Public database Exons Laboratory Retrieve human DNA sequence Sequencing Bioinformatics Sequences Reference DNA sequence

Public database One example is the Ensembl Genome Browser
ftp://ftp.ensembl.org/pub/release-78/fasta/homo_sapiens/dna/ ftp://ftp.ensembl.org/pub/release-78/fasta/homo_sapiens/dna/

(4) Why do we need a reference DNA sequence?
The reference DNA does not contain mutations/SNPs and can therefore serve as a control The reference DNA informs us about the location of the exons We do not need it because we are interested in mutations in the DNA of the patient To obtain a list of known SNPs

(4) Why do we need a reference DNA sequence?
The reference DNA does not contain mutations/SNPs and can therefore serve as a control The reference DNA informs us about the location of the exons We do not need it because we are interested in mutations in the DNA of the patient To obtain a list of known SNPs Each of these answers is incorrect

Overall principle Patients DNA Public DNA database Exons Sequences
Clinic Obtain DNA DNA Exon capture Public DNA database Exons Laboratory Retrieve human DNA sequence Bioinformatics Sequencing Compare Sequences Reference sequence

(5) Why do we need to compare?
To find genes that are present in the patients but not in the reference DNA To find exons that are present in the patients but not in the reference DNA To find nucleotides that differ between the patients and the reference DNA To validate the sequences obtained from the patient

Overall principle Patient DNA Public DNA database Exons Sequences
Clinic Obtain DNA DNA Exon capture Public DNA database Exons Laboratory Retrieve human DNA sequence Bioinformatics Sequencing Compare Sequences Reference sequence Differences We compare the exon sequences of the patient to a reference DNA sequence obtained from a public database. This allows to identify nucleotide differences between the patient and a reference. One of these nucleotides may cause the disorder.

Clinic Obtain DNA DNA Exon capture Public DNA database Exons Laboratory Retrieve human DNA sequence Sequencing Compare Sequences Reference sequence Bioinformatics Differences Filtering Candidate SNPs

(6) What is in the list of candidate SNPs
The disease causing SNPs All SNPs in the reference sequence All differences that are not experimental errors (e.g. sequencing errors) All SNPs in the patients

(6) What is in the list of candidate SNPs
The disease causing SNPs All SNPs in the reference sequence All differences that are not experimental errors (e.g. sequencing errors) All SNPs in the patients By reducing (filtering) all differences that we identified we end up with a list with fewer differences (i.e., the candidate SNPs). We remove all differences of which we think are not related to the disorder This list may contain the disease causing gene if it is not removed in this filtering step. We also aim to remove differences that are due to sequencing errors.

Clinic Obtain DNA DNA Exon capture Public DNA database Exons Laboratory Retrieve human DNA sequence Sequencing Compare Sequences Reference sequence Bioinformatics Differences How to select candidate SNPs from all differences? Write down a few options on the blackboard. Candidate SNPs

Clinic Obtain DNA DNA Exon capture Public DNA database Exons Laboratory Retrieve human DNA sequence Sequencing Compare Sequences Reference sequence Differences Bioinformatics Filtering Candidate SNPs Validation Laboratory Disease causing SNP

(7) Why do we need to validate?
To remove sequencing errors To understand the function of the SNP To understand the function of the gene To check if the identified SNP is indeed related to the disease

Clinic Obtain DNA DNA Exon capture Public DNA database Exons Laboratory Retrieve human DNA sequence Sequencing Compare Sequences Reference sequence Differences Bioinformatics Filtering Clinic Candidate SNPs Validation -Diagnostics/ -Treatment -Research Laboratory Report Disease causing SNP

ONE STEP BACK Patients DNA Public DNA database Exons Sequences
Clinic ONE STEP BACK Obtain DNA DNA Exon capture Public DNA database Exons Laboratory Retrieve human DNA sequence Sequencing Compare Sequences Reference sequence Differences Bioinformatics Filtering Clinic Candidate SNPs Validation -Diagnostics/ -Treatment -Research Laboratory Report Disease causing SNP

Compare patient sequence to reference DNA
Gene A Gene B Reference DNA from public database Exon ctgtatcttgtcgttcggatctaatgccctgcagagatctcatg Note: blue line is alignment of DNA fragment (short sequence read) from patient against an exon of a reference sequence that was obtained from a public database. atcttgtcgttcggatctagtgccctgcagagatct DNA fragment (sequence read) from patient difference AG (SNP or sequencing error?) Result: list of variants that differ between patients and reference

Result comparison 1: List of differences: patient(s) compared to reference List of differences with reference DNA

ONE STEP BACK Patients DNA Public DNA database Exons Sequences
Clinic ONE STEP BACK Obtain DNA DNA Exon capture Public DNA database Exons Laboratory Retrieve human DNA sequence Sequencing Compare Sequences Reference sequence Differences Bioinformatics Filtering Clinic Candidate SNPs Validation -Diagnostics/ -Treatment -Research Laboratory Report Disease causing SNP

Filtering: comparison of patients
Patient 1 (Nicolaides Baraitser) Patient 2 (Nicolaides Baraitser) Patient 3 (Nicolaides Baraitser) Patient 4 (Nicolaides Baraitser) Patient 5 (Nicolaides Baraitser) Patient 6 (Nicolaides Baraitser) Result: list of variants that the patients have in common candidate gene (shares mutation for all patients) mutation

Results after patient comparison
1: List of differences: patient(s) compared to reference 2: List of SNPs shared between patients List of SNPs shared between patients Candidate SNPs List of differences with reference DNA

Filtering: remove synonymous SNPs
Synonymous SNPs do not change the protein

Results after removing synonymous SNPs
1: List of differences: patient(s) compared to reference 2: List of SNPs shared between patients 3: List of Synonymous SNPs By including more filters we reduce our list of candidate genes List of SNPs shared between patients Candidate SNPs List of differences with reference DNA Synonymous SNPs

The story of Nicholas Volker
Worthey EA, et al (2011) Making a definitive diagnosis: successful clinical application of whole exome sequencing in a child with intractable inflammatory bowel disease. Genetics in Medicine,13(3), 255

The story of Nicholas Volker (1)
A male child who presented at 15 months with Crohn disease-like illness. The age and severity of the presentation suggested an underlying immune defect; Despite comprehensive clinical evaluation they were unable to arrive at a definitive diagnosis Thereby restricting clinical management. abdomen = buik colostomy = is a surgical procedure in which a stoma is formed by drawing the healthy end of the large intestine or colon through an incision in the anterior abdominal wall and suturing it into place. Mucus fistula = opening created in the abdominal wall as an alternate path for feces or urine to reach outside the body A fistula is an abnormal communication between 2 epithelialized surfaces, with an enterocutaneous fistula (ECF) being an abnormal communication between the small or large bowel and the skin Clinical presentation Anterior abdomen showing the expanded abdominal wall defect containing colostomy and mucus fistula (arrow). Note formation of multiple new enterocutaneous fistulae (arrowheads).

Identification of the causative mutation(s) through exome sequencing to provide the necessary additional information required for clinical management. Identified a novel missense mutation in the X-linked inhibitor of apoptosis gene

In concordance with the recommended treatment for X-linked inhibitor of apoptosis deficiency: a progenitor cell transplant was performed to prevent life-threatening hemophagocytic lymphohistiocytosis (hematological disorder) At 42 days post-transplant, the child was able to eat and drink Wikipedia: Hemophagocytic lymphohistiocytosis (HLH), also known hemophagocytic or haemophagocytic syndrome, is an uncommon hematologic disorder. It is a life-threatening disease of severe hyperinflammation caused by uncontrolled proliferation of activated lymphocytes and macrophages characterised by proliferation of morphologically benign lymphocytes and macrophages that secrete high amounts of inflammatory cytokines.

There has been no recurrence of gastrointestinal disease, suggesting this mutation also drove the gastrointestinal disease. X-linked inhibitor of apoptosis is now seen as a novel cause of inflammatory bowel disease. It demonstrates the power of exome sequencing to render a molecular diagnosis in an individual patient in the setting of a novel disease, after all standard diagnoses were exhausted, and illustrates how this technology can be used in a clinical setting. Note: the exome of only 1 patient was available

Video Alternative:

Questions?

Exome sequening: the principle

Similar presentations

Presentation on theme: "Exome sequening: the principle"— Presentation transcript:

Similar presentations

About project

Feedback

Log in

Auth with social network:

Exome sequening: the principle

Similar presentations

Presentation on theme: "Exome sequening: the principle"— Presentation transcript:

Similar presentations

About project

Feedback