1. Development of microarray-based method for genotyping of avian viral pathogens
D.B. Andreychuk1, V.V. Drygin1
1 FGBI Federal Centre for Animal Health, Vladimir, Russia
New principle of cDNA-microarray genotyping of avian viral pathogens is developed. Newcastle disease virus (II genotype vaccine strain La-Sota), and also 4 artificially synthesized RNA oligonucleotides, corresponding to a fragment of the La-Sota strain genome ( nucl.) was used as a model for development and approbation of the method. RNA oligonucleotides contained one nucleotide mismatch in a certain position (Fig.1). The method allowed to reveal virus RNA as directly from pathological material (RNA isolation directly on the microarray with the subsequent hybridization on the specific immobilized probes), and to work with RNA isolated separately. Genetic typing were based on ligation reaction of the specific immobilized probes on which the virus nucleic acid was hybridized (Fig.2). Ligation reaction run at increased temperatures in a buffer with mild denaturation conditions. As a result high specificity of reaction which allowed not only to reveal of viral RNA was reached, but also to differentiate virus RNA molecules that vary in a certain position single nucleotide replacement (Fig.3). Genetic SNP-typing specificity was provided also as the three-probe architecture of the microarray – only at hybridization of studied RNA/cDNA on 3 probes (one - immobilized reverse transcription DNA probe and two - immobilized differentiating DNA probes) formed a positive signal of reaction. To increase a method sensitivity an isothermal amplification (NASBA) of specifically reacted probes was applied (Fig.2). As a result of reaction immobilized amplicons were received. The subsequent hybridization of these amplicons with Cy5-fluorescent probes allowed to visualize a positive signal and to read out result of reaction by means of the confocal laser microarray scanner “LS reloaded” (Tekan, Shwitzerland). Application of isothermal amplification with the subsequent hybridization of fluorescent probes allowed to increase sensitivity of reaction by times and to approach to sensitivity of PCR-based methods (Fig.3). Owing to refusal of PCR as intermediate step in microarray procedure this method possesses ample opportunities of multiplexing since all probes taking part in reaction are immobilized on the chip (spatially are separated from each other) and aren't subject to the interpriming interactions giving a nonspecific signal.
This collaborative research was partially sponsored by ISTC project 3005 funded by the U.S. Department of Agriculture – Agricultural Research Service and the U.S. Department of State.
Fig. 2 Scheme of the microarray procedure. All reactions are carried out in a well of 96-well polystyrene plate. The microarray was plotted on a bottom surface of the well.
Fig. 1 Artificially synthesized RNA oligonucleotides for microarray probes specificity testing fully corresponding to a fragment of the La-Sota strain genome (RNA fragment “LaSota_NDV-C(Wt)”, nucl. GenBank La-Sota cDNA Ac. No.) or partially corresponding to this genome fragment (RNA fragments “LaSota_NDV-G”, “LaSota_NDV-A”, “LaSota_NDV-T”) with a mismatch at 506 nucleotide position (G, A and T)
GGTTCCGTTGCTGCATGCCCGAGGGAGAGATCCTGCTATCATCGTAAATCTCTGTGCTCTCTCTTCAGACACTCCACTCCTATTGTTGAACTGGGGCGTGC
LaSota_
NDV-T
GGTTCCGTTGCTGCATGCCCGAGGGAGAGATCCTGCTATCATCGAAAATCTCTGTGCTCTCTCTTCAGACACTCCACTCCTATTGTTGAACTGGGGCGTGC
NDV-A
GGTTCCGTTGCTGCATGCCCGAGGGAGAGATCCTGCTATCATCGGAAATCTCTGTGCTCTCTCTTCAGACACTCCACTCCTATTGTTGAACTGGGGCGTGC
NDV-G
GGTTCCGTTGCTGCATGCCCGAGGGAGAGATCCTGCTATCATCGCAAATCTCTGTGCTCTCTCTTCAGACACTCCACTCCTATTGTTGAACTGGGGCGTGC
NDV-C(Wt)
Preparing of 1% tissue suspension in PBS buffer
Tissue lysis and RNA hybridization on specific immobilized reverse
transcription DNA probes in a well with microarray (96-well format)
Derived immobilized cDNA genotyping by specific ligation of two immobilized differentiating DNA probes on this cDNA
Removing of unreacted reverse transcription and one of differentiatingDNA probes
and “linearization” reacted immobilized differentiating probe by DNA restriction endonucleases
Doing NASBA-reaction
with residual specific
ligated probes to
increase the specific
positive signal
cDNA synthesis on hybridized RNA with specific immobilized reverse
transcription DNA probes
Hybridization of derived in NASBA immobilized ss-cDNA with Cy-5 labeled probe
Scanning and
analyzing of
microarray image
Microarray
Probe
RNA
Reverce
Transcriptase
(Superscriptase III, Stratagene)
immobilized differentiating DNA probes
DNA-ligase
Derived immobilized specific cDNA
Discharge of immobilized ss-cDNA by treatment of denaturation solution
Accumulation of specific cRNAs (NASBA products) and hybridization with “free” specific immobilized differentiating DNA probes
T7-RNA-pol
AMV-rev
cDNA synthesis on hybridized cRNA with “free” specific differentiating probe
“common” specific primer elongation by AMV-reverse transcriptase
labeled probe
Су-5
Fig. 3 Results of specificity and sensitivity testing of the microarray-based method
3 lg EID50/ml
4 lg EID50/ml
Sensitivity of the microarray method was tested on several samples NDV (“LaSota” strain) with different (10-fold step) titer (the titer of NDV is indicated next to microarray result (microarray spot))
Specificity of the microarray method was tested by artificially synthesized RNA oligonucleotides with concentration of 10 pmol/mkl in samples (the type of RNA oligonucleotide with definite nucleotide mismatch (Fig.1) is indicated next to microarray result (microarray spot))
6 lg EID50/ml
LaSota_NDV-A (differs from the LaSota genome fragment – “A” substitution in 506 nucl. position)
LaSota_NDV-G (differs from the LaSota genome fragment – “G” substitution in 506 nucl. position)
LaSota_NDV-T (differs from the LaSota genome fragment – “T” substitution in 506 nucl. position)
LaSota_NDV-C(Wt) (completely fits to the LaSota genome fragment)
5 lg EID50/ml
2 lg EID50/ml
1 lg EID50/ml
1 EID50/ml
Negative control