Presentation is loading. Please wait.

Presentation is loading. Please wait.

AKSHAY KATIYAR Advanced Centre for Plant Virology

Similar presentations


Presentation on theme: "AKSHAY KATIYAR Advanced Centre for Plant Virology"— Presentation transcript:

1 Genomic properties of Potato virus M occurring in northern plain of India
AKSHAY KATIYAR Advanced Centre for Plant Virology Division of Plant Pathology Indian Agricultural Research Institute

2 POTATO (Solanum tuberosum)
Third most important food crop of the world India, second largest producer share about 12.2% in world potato production after China (FAOSTAT data, 2014). Viruses are the major problem in Potato crop causing yield loss upto 90%. HEALTHY VIRUS INFECTED Major production from India (85% ) Uttar Pradesh West Bengal Bihar Karnataka Madhya Pradesh Gujarat Jharkhand, Punjab

3 Viral and viroid diseases of potato
Alfalfa mosaic virus Andean potato latent virus Andean potato mottle virus Arracacha virus B - Oca strain Beet curly top virus Cucumber mosaic virus Eggplant mottle dwarf virus Potato aucuba mosaic virus Potato black ringspot virus Potato deforming mosaic virus Potato latent virus Potato leafroll virus Potato mop-top virus Potato rugose mosaic Potato stem mottle virus Potato spindle tuber viroid Potato yellow dwarf virus Potato yellow vein virus Potato yellowing virus Potato virus A Potato virus M Potato virus S Potato virus T Potato virus U Potato virus V Potato virus X Potato virus Y Sowbane mosaic virus Tobacco mosaic virus Tobacco necrosis virus Tomato yellow mosaic virus Wild potato mosaic virus Tobacco rattle virus Tobacco streak virus Tomato black ring virus Tomato mosaic virus Tomato spotted wilt virus Potato Viruses in INDIA Potato leafroll virus Potato virus A Potato virus M Potato virus S Potato virus X Potato virus Y Tomato leaf curl virus Groundnut bud necrosis virus Viruses are the major threat in potato production and a total of 36 viruses and viroids are reported worldwide in potato (Tiwari, 2012; Raigond, 2013) that significantly reduces the yield of potato.

4 Detection of Potato virus in the field samples collected from North region of India by ELISA
PVX PVY 27/57 PVM 18/78 PVS 9/21 PLRV PVA 14/21 PVX 28/146 PVY 34/179 PVM 33/179 PVS 24/179 PLRV 1/146 PVA 1/57 PVX 2/8 PVY 10/36 PVM 10/44 PVS 0/8 PLRV 0/8 PVA 5/44 PVX 118/410 PVY 141/463 PVM 74/490 PVS /490 PLRV 31/133 PVA 24/330 TOTAL PVX 148/564 (26%) PVY /796(29%) PVM 169/852(20%) PVS 54/698 (8%) PLRV 52/348 (14%) PVA /513 (8%) PVX PVY 22/61 PVM 34/61 PVS PLRV 20/61 PVA 0/61 Uttar Pradesh Madhya Pradesh West bangal Bihar Delhi

5 Specific Detection of six RNA viruses infecting Potato in India
PVM PVS PVX PVY PVA PLRV INOCULATION OF DIFFERENT POTATO VIRUSES IN GLASS HOUSE 300 bp 500 bp 1000 bp M PVX PVY PVA PVS PVM PLRV 1008 bp 800 bp 616 bp 504 bp 445 bp 345 bp Specific Detection of six RNA viruses infecting Potato in India (Mandal et al., 2012) (Shilpi et al., 2013) (Jeevalatha et al.,2013) Sap Inoculation

6 Question : Why Potato virus M ?
PVM has been characterized in India only on the basis of their biological properties, transmission, host range and yield loss. Causing yield loss Between 15% and 45% (CPRI Annual Report ) Infection results in significant decrease in size and number of tubers. PVM incidence increased continuously during the period of study Availability of only six complete genome sequence all over the world. No sequence data was available of PVM from India. PVM stains have remarkable diversity as per existing reports. First reported in Solanum tuberosum; from the U.S.A.; by Schultz and Folsom (1923); Bagnall et al. (1956).. Symptoms: Causes mottling, mosaic, crinkling and abaxial rolling of leaves, and stunting of shoots.. Healthy Infected

7 Genus : Carlavirus Family : Flexiviridae Particle Genome Transmission
Potato virus M Family : Flexiviridae Particle : Filamentous,Flexuous rods, 650x12 nm, not enveloped, usually straight (to slightly curved) Genome : Single stranded RNA, positive-sense, 5’ cap, 6 ORFs, 3’ poly A tail Size approx. 8.5 kb Transmission : Vector an insect; Myzus persicae Non-persistent manner. Mechanical inoculation, grafting Not transmitted by seed and pollen Host : Natural: mainly solanaceae (potato) Experimental: chenopodiaceae, leguminosae and solanaceae Distribution : World wide Genome REPLICASE TGB1 TGB2 TGB3 CP NAB (A)n3'UTR 5'UTR Transmission

8 STRATEGY AND PRIMER USED FOR COMPLETE GENOME
Schematic representation of the strategy used for the amplification and List of primers used for amplification of complete genome of Indian isolate of Potato virus M (PVM-Del-144) isolated from Solanum tuberosum Question : Is our isolate is different from other submitted PVM genome?

9 PVM-Del-144 Percent sequence identity of Potato virus M-Del-144 isolate with the other isolates reported worldwide Isolates Country Accession no Genome length (bp) Complete genome 5' UTR 3' UTR ORF1 nt/aa ORF2 ORF3 ORF4 ORF5 ORF6 Gansu China JN835299 8,520 92.8 92 96.2 92.1/93.5 93.0/96.9 94.8/97.2 94.7/95.3 93.2/98.0 97.6/96.5 VIRUBRA 4/007 Czech Republic HM854296 8,474 92.2 61.3 39.4 92.1/93.3 92.8/94.7 93.9/97.2 95.8/95.3 93.9/96.7 92.7/91.3 M57 Poland AY311395 8,522 93.6 93.3 98.1 93.1/94.2 94.7/99.1 93.0/95.4 94.7/98.6 96.8/96.5 Uran AY311394 93.4 93.0/93.9 93.1/96.9 95.1/97.2 93.2/93.7 94.0/98.0 97.3/96.5 DSMZ PV0273 Germany EU604672 8,523 93.9 71.8 93.2/93.9 93.6/96.5 94.8/96.3 96.2/99.0 93.3/92.1 Russian wild Russia D14449 8,533 93.1 74.6 92.3/92.4 94.3/97.8 94.5/97.2 92.7/89.0 95.6/97.7 91.0/87.8 Phylogenetic tree of Potato virus M isolates based on the maximum parsimony analysis of complete genome. Our isolate shown in highlighted portion

10 Coat protein gene specific primers
Host reactions difference between Indian isolate of Potato virus M (PVM-Del-144) and other reported isolates. Phaseolus vulgaris Solanum lycopersicum RT-PCR confirmation Host Range study BM455F 5' ATCTGAAATAGTGAGTATGGG 3' BM587R 5' GC CAC CTT GGT TAC GTG CTT 3' Coat protein gene specific primers Datura metel Solanum tuberosum M +ve H Plant species Symptoms References PVM-Del-144 Other isolates Solanum tuberosum Abaxial leaf rolling, necrosis and stunting of plant Mottle, mosaic, crinkling and rolling of leaves and stunting of shoots Huimin Xu et al., 2010 Phaseolus vulgaris Faint grayish local lesion that turned to dark brown in advanced stage Local necrotic lesion on primary leaves Bangall et al.,1956, 1959;Kowalska and was,1976; Slack,1983; Edwardson and Christie,1997 Datura metel Local lesion on leaf non systemic Local chlorotic spotting and systemic chlorotic mottling and rugosity Bangall et al.,1956, 1959;Kowalska and was,1976; Slack,1983; Edwardson and Christie,1997 Nicotiana benthamiana Twisting of leaves Symptomless S.Flatken et al., 2008 Solanum lycopersicum Yellowing of leaves Gomphrena globosa Non host Local cholrotic rings or necrotic spots C.Hiruki Chenopodium quinoa Chlorotic local lesions N. Glutinosa No infection N. Tabacum Bangall et al.,1956, 1959;Kowalska and was, 1976; Slack,1983; Edwardson and Christie,1997

11 Disease diversity at field
PVM-7 PVM-6 PVM-4 Disease diversity at field Question : Is there is any genetic diversity in PVM genome? Indication of the existence of molecular diversity Collect symptomatic plant leaves from IARI experimental field Confirmed presence of potato virus M by RT PCR with CP specific primer Out of seven sample three samples were found positive (4,6,7) But sample No 4 is not giving amplification if we tried any other primer of PVM genome M Partial genome amplification of PVM 3200 5100 4700 M H +ve 915 Coat protein gene amplification of PVM AMPLIFICATION VARIATION WITH DIFFERENT SETS OF PRIMER

12 Detection of Potato virus M in the field samples collected from different region of India by direct antigen-coated enzyme-linked immunosorbent assay using commercial polyclonal antisera Place Year of collection No. positive/ No. tested (%) OD range for positive samplesa Jalpaiguri Vaishali Patna IARI field-1 2012 7/10 (70) 9/21(42.8) 9/22(40.9) 10/27(37.0) IARI field-2 5/85 (5.9) IARI field-3 IARI field-4 2014 19/53 (35.8) IARI field-5 Meerut 2013 17/160 (10.6) 13/20(65.0) Balia 4/22 (18.2) Gajipur 2/13 (15.4) Kolkata 3/8 (37.5) Agra 4/25 (16) Mathura 3/6 (50) Jaunpur 4/33 (12.1) Mirjapur 4/15 (16.7) Hatrus 1/21 (4.8) 0.321 Kannauj Indore Ujjain 1/11 (9.1) 18/31(58.0) 16/30(53.33) 0.158 Total 154/698 (22.0) Map of India showing the major potato growing area in North India from where infected potato samples were collected and percent of potato virus M (PVM) incidence in those areas evaluated based on serological diagnosis aThe OD value was taken at A405 nm after 1 h of addition of substrate. Samples with absorbance value more than two times of healthy control ( ) were considered as ELISA positive.

13 Cloning and sequencing
s.no Isolate Collected area Genome location Size(bp) Accession no 1 PVM-Del-144 IARI , Delhi Complete genome 8523 KJ194171 2 M34 coat protein 915 KF471070 3 Jau-33 Jaunpur, UP coat protein+3’UTR 1300 KJ473993 4 Gaj-13 Gazipur,UP KJ473992 5 Del-147 KJ462137 6 Bal-21 Baliya, UP KJ462133 7 Mir-12 Mirjapur, UP KJ462134 8 Del-123 KJ462135 9 Del-134 KJ472136 10 Mat-12 Mathura, UP KJ569697 11 PVM-Del-133 KJ569696 12 Agf-5 Agra, UP KJ919964 13 Kan-16 Kannauj, UP KJ919965 14 Hat-12 Hathrus, UP KJ919966 RNA ISOLATION PCR/RT-PCR (cp primer) TA vector Cloning Sequencing

14 Potato Virus M : Genetic diversity
KJ (Del-144) India 100% SCALE KF (M34) India 99% KJ (Del-134) India 95% KJ (Del-123) India 90% KJ (Del-147) India 85% KJ (AGF-5) India 98% 80% KJ (Kan-16)India 75% KJ (Del-133) India 76% 77% 70% KJ (Hat-12)India 97% KJ (Jau-33) India 96% KJ (Bal-21) India 94% KJ (Mir-12) India KJ (Mat-12) India KJ (Gaj-13) India 93% 92% Maximum parsimony tree of Indian isolates of Potato virus M PVM-o PVM-d Sequence Identity Matrix of coat protein gene sequence of Indian isolates ICTV Species Demarcation criteria

15 Validation of specificity of primers
Designing of specific primers for the specific detection of PVM-d isolate PRIMER PRIMER SEQUENCE Tm (C) Amplicon length BM761F     5` AGCAAGAGAGCGAGCACATC 3` 60 737 Bp BM764R   5`CTCGGAGTGGGCCTCCTT3` 59 Validation of specificity of primers by using the cloned DNA M M: Marker Lane 1 : Gaj-13 Lane 2 : Del-144 Lane 3 : Del-133 Lane 4 : Bal-21 Lane 5 : Del-147 Lane 6 : Hat-12 Lane 7 : Del-123 1500 500

16 Conclusions first time the complete genome sequence of an Indian isolate of Potato virus M. our isolate (PVM-Del-144) is different from all other previously reported PVM isolates based on their biology as well as on their molecular properties. PVM incidence in the potato fields in India was found 22% which is almost two times higher than reported from Iran (Fatemeh et al. 2014) and it is continuously increasing from last three years. Existence of two different genotypes of Potato virus M in India and we have developed the primers for the specific detection of both the genotypes.

17 Research ahead: Need to carry out further study on Genetic diversity and their distribution Current study shows the existence of biological variants: PVM strains in India need to be well characterised Need to develop infectious clone of PVM for study of viral gene function and host pathogen interaction

18 Acknowledgements Contribution
Dr. Alok Kumar (Post Doctoral Scientist, ILRI, Ethiopia, Africa) Guidance Dr. Bikash Mandal (Principal Scientist, IARI, N. Delhi) Dr. Anirban Roy ( Sen. Scientist Advanced Center for Plant Virology, N. Delhi) Dr. G.P. Rao (Principal Scientist, IARI, N. Delhi) Dr. V. K. Baranwal (Incharge, Advanced Center for Plant Virology,N. Delhi) Financial support Department of Biotechnology & ICAR Travel & accommodation Indian Virological Society

19 Thank you


Download ppt "AKSHAY KATIYAR Advanced Centre for Plant Virology"

Similar presentations


Ads by Google