1. Bioinformatics for Research
2/9/2018
Bioinformatics for Research
Module 1 Introduction to Genomics and Bioinformatics January 12, 2017
Mainlab Bioinformatics Washington State University

2. Introduction to Genomics
Learning Outcomes
Refresh your knowledge of basic genomic concepts and terminology
Understand conceptually the different areas of genomic research
Know the basic tools of genomics

3. Prokaryotes vs. Eukaryotes
No nucleus
Nucleus
Circular or linear chromosomes, plasmids
Chromosomes in nucleus, mitochondria and chloroplasts also have genomes
Polycistronic operons (multiple genes controlled by single promoter)
Monocistronic operons (one gene, one promoter)
No introns
Introns
Created By Marwa Naguib Mohamed

4. The central dogma of genetics
mRNA
protein
trait
translation
expression
transcription

5. DNA nucleotides Standard Bases Degenerate Bases Abbreviation Base A
Adenosine C
Cytidine G
Guanosine T
Thymidine U
Uridine
Abbreviation
Base W
A, T S
C, G M
A, C K
G, T R
A, G Y
C, T B
C, G, T D
A, G, T H
A, C, T V
A, C, G
Created By Marwa Naguib Mohamed

6. Genes and ORFs
Gene
A DNA segment that encodes a specific protein that contributes to the expression of a trait
Open Reading Frame (ORF)
Section of mRNA without stop codons that is translated
Created By Marwa Naguib Mohamed

7. Structure of a Gene
Regulatory regions: up to 50 kb upstream of +1 site
Exons: protein coding and untranslated regions (UTR)
1 to 178 exons per gene (mean 8.8)
8 bp to 17 kb per exon (mean 145 bp)
Introns: splice acceptor and donor sites, other DNA
average 1 kb – 50 kb per intron

8. DNA to RNA to Protein

9. Amino Acids
mRNA is translated into protein which is a series of amino acids
Each amino acid is coded for by a 3 nucleotide codon
Each amino acid has a unique structure and chemical properties
Created By Marwa Naguib Mohamed

10. Amino Acid Codon Table

11. Substitution Matrices

12. Protein structure
Properties of amino acids determine the structure of the protein
Structure is important for protein function
Mutations that alter structure can destabilize/inactivate the protein

13. What is a Genome?
The DNA content of an organism. Contains all the biological information needed to construct and maintain an organism
In eukaryotic organisms, it is measured in haploid equivalents
Size is most commonly measured in base pairs (e.g. Mb)
Genome sizes vary widely in size and do not correspond to the complexity of an organism

14. Basic Genome Statistics
Chromosome number and ploidy
GC content
Genome size
Codon bias
Gene content and order
What is the chromosome number of your favorite organism and how many genes does it have?

15. Genomics vs Genetics
Genomics is the study of
Genetics is the study of

16. Genomics Comprises
Structural Genomics The study of genome structure and organization on a large scale
Functional Genomics The study of gene (and protein) function on a large scale
Translational Genomics The adaptation of information derived from genome technologies for organism improvement
What about Comparative Genomics?

17. Structural Genomics
The study of genome structure and organization on a large scale
Tools of Structural Genomics

18. Functional Genomics
The study of gene function and expression on a large scale
Tools of Functional Genomics
EST libraries (cDNAs)
RNA-Seq technology
Next Generation Sequencing Technology
Real time PCR

19. Translational Genomics
Transferring the knowledge gained from one species to another or translating basic knowledge to applied knowledge.
As we identify gene(s) associated with interesting traits, markers can be identified for marker-assisted selection.

20. Traditional Breeding X Successive Backcrosses Improved cultivar
Waiting years to select for trees
Wild species
undesirable fruit
low yield
disease resistance
Cultivar
desirable fruit
high yield
disease susceptible
Successive Backcrosses
Improved cultivar

21. Molecular Breeding X X Improved cultivar Wild species
Select desired progeny
long before any fruit is grown
using molecular markers for the trait
Wild species
undesirable fruit
low yield
disease resistance
Cultivar
desirable fruit
high yield
disease susceptible
Improved cultivar

22. Assignment – Extra Credit (10 Pts)
There are many different types of “-omics” that have emerged in the last few years. Please define each of the types below in one paragraph (do not copy from a website). to Jodi by Friday Sept 4
Transcriptomics is the study of ….
Proteomics is the study of ….
Metabolomics is the study of ….
Phenomics is the study of …..
Created By Marwa Naguib Mohamed

23. Overview of Bioinformatics
Learning Outcomes
Understand the broad concept and approaches used in bioinformatics

24. What is Bioinformatics ?
Bioinformatics Working Definition
The application of information technology, computer science, mathematics and statistics to the organization, processing, storage, analysis, visualization and dissemination of genomic, genetic and breeding data.
What is the Range of Bioinformatics ?
Mathematical modeling of biological systems
Developing algorithms for sequence and network analysis
Building databases and web tools

25. Bioinformatics Approach
Mathematical Modeling: Abstraction of biological systems - DNA is a “String”
Developing Algorithms for Sequence Analysis - Analysis of “Strings”
Sequence alignment
Sequence composition
Building databases and web tools - Dissemination and data mining of “Strings”

26. Bioinformatics Approach
Mathematical Modeling: Abstraction of biological systems DNA is a “String”
TAAGTTATTATTTAGTTAATACTTTTAACAATATTATTAAGGTATTTAAAAAATACTATTATAGTATTTAACATAGTTAAATACCTTCCTTAATACTGTTAAATTATATTCAATCAATACATATATAATATTATTAAAATACTTGATAAGTATTATTTAGATATTAGACAAATACTAATTTTATATTGCTTTAATACTTAATAAATACTACTTATGTATTAAGTAAATATTACTGTAATACTAATAACAATATTATTACAATATGCTAGAATAATATTGCTAGTATCAATAATTACTAATATAGTATTAGGAAAATACCATAATAATATTTCTACATAATACTAAGTTAATACTATGTGTAGAATAATAAATAATCAGATTAAAAAAATTTTATTTATCTGAAACATATTTAATCAATTGAACTGATTATTTTCAGCAGTAATAATTACATATGTACATAGTACATATGTAAAATATCATTAATTTCTGTTATATATAATAGTATCTATTTTAGAGAGTATTAATTATTACTATAATTAAGCATTTATGCTTAATTATAAGCTTTTTATGAACAAAATTA

27. Bioinformatics Approach
Mathematical Modeling: Abstraction of biological systems - DNA is a “String”
Developing Algorithms for Sequence Analysis - Analysis of “Strings”
Sequence alignment
Sequence composition
Building databases and web tools - Dissemination and data mining of “Strings”

28. Sequence Alignment
Pairwise Sequence Comparison is the cornerstone of bioinformatics
Infer function (homology)
Orthologs (occur in separate species, common ancestors)
Parology (Gene duplication independent of speciation)
Build Evolutionary Trees
Do whole genome comparisons
Infer structure

29. Assembly Algorithms: Newbler, Velvet, Mira, Celera, CAP3, PHRAP, etc.
e.g. GDR Unigenes

30. Multiple Sequence Alignment

31. Phylogenetic Analysis
Fragaria: Member of the distantly-related Rosoideae (x = 7)
Malus and Prunus: Members of the Spireaoideae (x = 17) and (x = 8) respectively

32. Domain Prediction

33. Genome Mapping/Comparison
Prunus
Malus
Rosaceae
N=9
Fragaria
FC FC 7
PC PC 8
MC MC17
The innermost circle represents the nine ancestral chromosomes of Rosaceae.
The eight chromosomes of peach are repeated, each section showing the regions that are orthologous to each ancestral chromosome.
Concentric circle enables us to identify the ancestral relationships and origins (breakage and fusion).

34. Genome Annotation

35. Visualization Tools Comparative Mapping: CMap
Genome Browsers: GBrowse/JBrowse, etc

36. Structural Bioinformatics

37. Statistical Analysis of Functional Genomics Data
What statistical measures can be used to quantify up and down regulation of genes
Technical and biological error
Arrays
RNA Seq

38. Bioinformatics Approach
Mathematical Modeling: Abstraction of biological systems - DNA is a “String”
Developing Algorithms for Sequence Analysis - Analysis of “Strings”
Sequence alignment
Sequence composition
Building databases and web tools - Dissemination and data mining of “Strings”

39. Database Resources

40. Database Similarity Searching
Primary databases and community databases

41. NCBI : Primary Database for Genomics Data

42. Querying Databases

43. Querying Databases