1. Methods to produce marker‐free transgenic plants
Lecture 12
Methods to produce marker‐free transgenic plants
Dr. Aparna Islam

2. The purpose of transgenic plant
World Bank Report:
– If distributed evenly, the world’s food supply can feed 6.4 billion
(2350 calories/person); is even distribution a viable option?
– Cultivation lands will drop from 0.26 hectare /person in 1997 to 0.15 in 2050.
Increase population
Decrease off cultivable land
Susceptibility of crops towards pest, diseases, environmental stresses
Climate change
EIDs

3. Applications of transgenic plant
Improving crop resistance towards biotic factors (like, pest and diseases) and abiotic factors (like drought, heat, flooding) thus improving yield by minimizing the losses.
It is also possible to improving nutritional values overcoming breeding barrier.

4. Processes of transgenic plant technology
Success of genetic engineering is largely dependent on regeneration from the transformed cells. Marker genes play an important role in this regard. Regeneration of transgenic plant is based on efficient differentiation of the transformed cells from the non-transformed ones. The markers are widely used only to do the screening the transformed plant lines and these selection marker genes have no functional values once the transgenics are produced.

5. Current selectable marker genes
A gene identified cells that have been transfomed or transfected with a vector
Positive selection
– Antibiotics
– Herbicides
– Carbon supply
– Phytohormone precursor
(Miki and McHugh, 2004)

6. Antibiotic resistance genes
(Sakthivel et al., 2008)

7. Herbicide resistance genes

8. Potential pitfalls of resistant selection methods
Public concerns biological hazards
–Widespread in ecosystem, environmental effect
– Food and health safety

9. Methods to produce resistant marker‐free transgenic plants
A. Alternatives to Selectable Marker Genes
B. Elimination of Marker Genes
i. Co-transformation
ii. Site-specific Recombination
iii. Transposition
iv. Intra-Chromosomal Homologous Recombination
C. Transgenic Strategy without Selectable Marker Gene

10. Methods to produce resistant marker‐free transgenic plants
Strategies
– Non‐antibiotic or herbicide resistance gene
– Excise or segregate resistant marker gene
• Co‐transformation
• Site‐specific recombination
• Intrachromosomal recombination
• Transposon

11. Markers not based on antibiotic or herbicide resistance
• Selection
– Nutrients; – Morphologies
Relies on non-toxic substances that may be the ideal substrates for development or may stimulate growth of transformed cell or tissues, is so called positive selection system

12. Analysis of mannose selection used for transformation of sugar beet
Nutrient Selection
Analysis of mannose selection used for transformation of sugar beet
PMI: phosphomannose isomerase
Mannose‐6‐phosphate
fructose‐6‐phosphate
(Okkels et al., 1998)
At least 10 times more proficient and frequent than the protocols based on kanamycin selection.

13. Methods to produce resistant marker‐free transgenic plants
Strategies
– Non‐antibiotic or herbicide resistance gene
– Excise or segregate resistant marker gene
• Co‐transformation
• Site‐specific recombination
• Transposon
• Intrachromosomal recombination

14. Co‐transformation
In this approach, usually, the selectable marker gene is physically separated from the gene of interest. The principle of the strategy is to integrate of gene of interest and the selection marker gene into different unlinked locations of the plant genome and their subsequent crossing can separate the gene of interest from the selection marker gene.
The segregation functions, usually, at the progeny level. However, Co- transformation can be initiated for the removal of the marker genes with the gene of interest and selection marker gene on different T-DNA residing on the same binary vector or, on different binary vector residing on the same Agrobacterium strain or, on two different Agrobacterium strains.

15. Co-transformation Explant with GOI and Marker GeneLB P
GOI T RB LB P
Marker Gene T RB
Explant with GOI and Marker Gene
T0 with GOI and Marker Gene
Law of Segregation
T1 Plant with GOI only
T1 Plant with Marker Gene only

16. Co‐transformation using a negative selectable marker gene for the production of selectable marker gene free transgenic plants
codA
GUS
• npt II: Kanamycin resistant
• codA: Cytosine deamidase
5‐fluorocytosine (5‐FC):non-toxic
5‐fluorouracil (5‐FU): toxic
Park et al. successfully produced marker free transgenic tobacco plants using a negative selectable marker gene with two binary vector pNC and pHG of an Agrobacterium strain LBA4404. pNC binary vector contained a T-DNA with a codA (negative selectable marker gene) next to the npt2 gene and pHG contained a GUS reporter gene.

17. Limitation of Co-transformation technique:
This method, usually, relies on the segregation of genes during sexual reproduction. Therefore,
1. it cannot be used for vegetatively propagated plants. So that, this method is only compatible only for sexually propagated fertile plants
2. very time consuming.
3. the tight linkage between co-integrated DNAs may limit the efficiency of co-transformation.
4. This method is also not applicable to transgenic trees with long generation times.
5. The progeny selection with the desired genes may also be very laborious.

18. Site‐specific recombination‐mediated marker deletion
Systems
– Cre/loxp:
E.coli Bacteriophage P1
– FLP/FRT:
Saccharomyces cerevisiae from 2-µm plasmids
– R/RS:
Zygosaccharomyces rouxii from pSR1 plasmid
The deletion of short, recognized DNA sequence with the activity of recombinase enzymes has been a major step to acquire the marker free transgenic plant.
These enzymes proceed as molecular cutters and glue, so that it can slice the specific sites
and join the sliced DNA fragments respectively.
Three well described procedures for removal of marker gene through recombinase enzyme have been successfully applied to produce marker free transgenic plants.

19. Site‐specific recombination‐mediated marker deletion
RBE: recombinase binding element
Core sequence
Mechanism:
(Hare and Chua, 2002)

20. Cre/loxp systems can be applied either by
Dale and Ow, pioneered the use of site specific recombination approach for marker gene elimination.
They used the Cre/loxp recombinase gene from the E. coli bacteriophage P1 for the removal of the selective marker gene where the cre recombinase catalyzes a reaction between two loxp sequences and results the marker gene excision between the lox sequences.
They applied this method successfully on the marker free tobacco regeneration through Agrobacterium containing binary vectors.
Cre/loxp systems can be applied either by
1. re-transformation or
2. by crossing over and
3. by auto excision system.
4. There are also some reports available to generating marker free transgenic plants through an inducible Cre/loxp system including the use of the some chemical inducers and the heat shock.

21. Limitation of site‐specific recombination‐mediated marker deletion:
leakiness of the recombinase regulation,
an additional step is required to activate the recombinase activity such as re-transformation, crossing over, agro-infiltration, chemical inducer, heat shock treatment etc.
This application is time consuming,
labor intensive, and
may introduce somaclonal variation

22. Transposon‐based marker methods
Komamine et al., 2001
This process is quite similar to site specific recombination where transposons or jumping genes are used instead of a recombination and recognition sites.
This method involves Agrobacterium-mediated transformation followed by intergenomic replacement after the incorporation of two allied genes and subsequent separation from the marker gene in the progeny or straight deletion of marker gene from the genome.

23. Transposon
Discovery: – 1940s – Barbara McClintock – Controlling element • Ac (Activator) • Ds (Disassociation)

24. Application of transposon to produced marker‐free transgenic plant
There are two fundamental individuality possessed by the autonomous Ac element for transposition that can be physically separated: a transposase coding gene (Ac) and the reversed duplicate termini (Ds elements).The approach makes the use of the Ac/Ds transposition system where Ds is a member of Ac/Ds family, can cut out itself from its position and transpose to other sites within a genome only in the existence of the autonomous Ac element and Ac transposase activity is vital for the expression of plant promoters

25. marker free transgenic rice was generated by manipulating the Ac/Ds transposable elements in which hpt was used as a marker gene and positioned into the transposable element Ds.

26. The advantage of this system is that, the selection marker gene will be lost in some somatic tissues due to failure of the Ds element reintegration. This makes the strategy suitable for removal of marker genes in vegetatively propagated plants.
However, marker removal via Ac/Ds elements is not much efficient due to the low incidence of occurrence.
To overcome this problem inducible system has been generated.

27. An inducible transposon system to terminate the function of a selectable marker in transgenic rice
• epsps:
–Glyphosate tolerance
–5‐enolpyruvylshikimate‐ 3‐phosphate synthase
• PR‐1a
–Salicylic acid (SA) induced promoter
SA‐induced transposed Un‐transposed
(Tu et al., 2008)

28. Intrachromosomal recombination system
• Non‐recombinase • Spontaneous excision – attp: attachment P region of bacteriophage λ
(Meyer et al., 2002)

29. Intrachromosomal recombination between attP regions as a tool to remove selectable marker genes from tobacco transgenes
(Meyer et al., 2000)
• npt II – Positive selection – Kanamycinr • tms 2 – Negative selection Mechanism • Naphthalene acetamide NAM NAA • [Auxin] Root development
- tms ‐+ tms2
This method requires transfer of transformed tissues to a selection medium followed by transfer to a non-selection medium to allow the loss of the selection marker gene.

30. Advantages: Disadvantages:
The ICR method of marker gene removal is relatively simple as it does not require the expression of a heterologous recombinase.
this technique does not require any sexual reproduction steps and could therefore be applied for vegetative propagated plants
Disadvantages:
ICR events in plants were found to be very exceptional
lengthy regeneration may increase the risk of somaclonal mutations.
this method has to be tested on a large number of plant species before its implementation.

31. Transgenic plants without the use of selectable marker genes
The simplest way to produce marker free transgenic, is to avoid the use of selectable marker genes in the transformation procedure. It is only achievable by identifying the transformed cells from the non-transformed one by molecular methods particularly. However, such a project is decidedly demanding even in the days of programmed analysis and polymerase chain reaction.
But the major drawback is that, there is no control over choosy growth of the transformants, and the researcher needs to screen several putative transformants to confirm the integration of the transgene(s), which is expensive and time consuming. Uninhibited regeneration of a huge figure of chimeric plants is an additional drawback.

32. Conclusion
Among the several technologies described, two have emerged with significant potential. The simplest is the co-transformation of genes of interest with selectable marker genes followed by the segregation of the separate genes through conventional genetics.
The more complicated strategy is the use of site-specific recombinases, under the control of inducible promoters, to excise the marker genes and excision machinery from the transgenic plant after selection has been achieved.
The field of marker gene removal continues to produce new innovations.

33. Development of selectable marker free, insect resistant, transgenic mustard (Brassica juncea) plants using Cre/lox mediated recombination Arpita Bala, Amit Roy, Ayan Das, Dipankar Chakraborti, and Sampa Das BMC Biotechnol. 2013; 13: 88. Published online 2013 October 21. doi:   /

34. Introduction
Brassica juncea (Indian mustard) is one of the most important sources of edible oil.
Accounts for 12% of the total edible oil throughout the world. 
Mustard cultivation is seriously affected by sap sucking hemipteran pest - Lipaphis erysimi (mustard aphid).
Aphid causes upto 90% yield loss of mustard.
In addition to the nutrient loss of plants, aphids also transmit pathogenic viruses which contributes to additional yield loss.

35. Pest-resistance
Chemical insecticides leads to evolution of resistant biotypes.
The most commonly used bio-control agent Bt (Bacillus thuringiensis) toxin is not useful for chewing insects such as lepidopteran and coleopterans but it is ineffective against hemipteran, group of sucking insect pests.
Other proteins including α- amylase inhibitor, ribosome– inactivating proteins, enzyme inhibitors, arcelins, chitinases, ureases, and lectins have been reported to be involved in plant defence against various insects.
Among these, plant lectins have been found to be potent insecticidal agents.
A homodimeric mannose binding Allium sativum leaf agglutinin (ASAL) exhibits insecticidal activity against sap sucking hemipterans namely, mustard aphid, rice brown planthopper, green leafhopper and chickpea aphid.
Consequently, transgenic expression of ASAL had been accomplished in mustard, rice, and chickpea.

36. Elimination of selection marker
Antibiotic/ herbicide resistant marker genes have been proven to be very useful in plant transformation for the initial selection of desired transgenic events.
However, presence of these genes in the genetically modified crops may render the crop less acceptable to the consumers.
Among several different approaches, Cre/lox mediated recombination strategy for selectable marker gene (SMG) elimination has been demonstrated to be effective in several plants including Brassica.
In this study exploiting Cre/lox mediated recombination strategy, attempt has been made for selectable marker gene elimination from Allium sativum leaf agglutinin (ASAL) expressing Brassica plants with hemipteran insect resistant phenotype.

37. Plant material
Brassica juncea cv. B-85 seeds were obtained from Berhampur Pulse Research Station, West Bengal, India and used for plant transformation.

38. Plant transformation vector
pBKhgASAL (~ 7.0 kb)
ASAL gene under the control of CaMV 35S promoter and nos terminator within HindIII/ EcoRI site.
Hygromycin resistance gene (hpt) cassette flanked by lox sites.
pBK16.2 (~10.6 kb)
1.1 kb cre coding sequence was cloned into the multiple cloning site of pCAMBIA3300 under CaMV35S promoter and terminator
bar gene as herbicide resistant selection marker.
restriction sites indicated as A1/B1, A2/B2 and A3/B3 indicate the primer sequences for ASAL, cre and hpt genes.
5′→3′: orientation of lox sequences.
LB: T-DNA left border; RB: T-DNA right border.
All these vectors were mobilized into the AGL-1 strain of Agrobacterium tumefaciens.

39. Mustard transformation
A. tumefaciens mediated transformation and regeneration of mustard were performed.
Selection media containing either 30 mg/l hygromycin or 5 mg/l bialaphos were used to select calli and shoots transformed by pBKhgASAL or pBK16.2.
After root induction the plants were transferred to soil in glass house at 25°C under a 16/8 h light/dark photoperiod regime. 
Identical regeneration steps were also carried out without infecting explants with A. tumefaciens. These explants were grown in the absence of antibiotics and used as control plants.

40. Southern blot analysis
Total genomic DNA was extracted from the mature leaves of one month old control and transgenic plants of T0 (both ASAL and cre plant types) and F1 hybrid lines.
Genomic DNA per line was digested with HindIII.
Probes used:
362 bp amplicon from the ASAL gene prepared by using primer pairs A1 and B1,
1.1 kb amplicon from the cre gene produced by using primer pairs A2 and B2,
980 bp amplicon from the hpt gene generated by using primer pairs A3 and B3.
Primers
Sequences
Annealing temperature (°C)
Amplicon size (bp)
A1 (ASAL forward)
5′ATGGCCAGGAACCTACTGACGA 3′ 56
362
B1 (ASAL reverse)
5′CTATCTTCTCTAGGTACCAGTA 3′
A2 (cre forward)
5′ ATGTCCAATTTACTGACC 3′ 58
1100
B2 (cre reverse)
5′ CTAATCGCCATCTTCCAGC 3′
A3 (hpt forward)
5′ GCTTTCCACTATCGGCGA 3′
980
B3 (hpt reverse)
5′ AAAGCCTGAACTCACCGC 3′

41. Development of ASAL and cre lines
Southern blot analysis was carried out to check successful integration of transgene in putatively transformed T0ASAL- lox-hpt-lox and cre - bar containing plants developed by Agrobacterium mediated transformation.
Plant no. LA, LB, LD, LF showed single copy insertion of ASAL gene, LC was a double copy insertion event and LE was found to be Southern negative (Figure A).
In case of cre plants, plant no. CA, CC, CD, CE were single copy insertion events and CB was found to be Southern negative (B).
Single copy insertion lines of ASAL and cre were used for further analysis.
Expression of ASAL was also confirmed by western blotting in the single copy ASAL insertion lines (C).

42. Molecular analysis of gene integration and expression in T0 lines
 A Southern blot analysis of genomic DNA from leaves of T0ASAL- lox- hpt - lox plants.
Lane 1: ASAL coding sequence as positive control
Lane 2: untransformed genomic DNA as negative control
Lanes 3–8: HindIII digested genomic DNA from six ASAL plants LA, LB, LC, LD, LE, LF. 
B Southern blot analysis of genomic DNA from leaves of T0cre-bar plants.
Lane 9:  cre coding sequence as positive control
Lane 10: untransformed genomic DNA as negative control
Lanes 11–15: HindIII digested genomic DNA from five cre plants CA, CB, CC, CD, CE. 
C Western blots analysis of protein from four T0Southern positive ASAL- lox-hpt-lox mustard plants.
Lane 1: native ASAL as positive control
Lane 2: crude protein from untransformed plant as negative control.
Lane 3 – 6: crude protein from four transgenic mustard plants LA, LB, LD, and LF.

43. Crossing of T1 transgenic lines
T0 plants were self pollinated to obtain T1 seeds.
Four T1 [ASAL-lox-hpt-lox] lines were crossed with four T1 [cre-bar] lines reciprocally.
Eight independent crosses of transgenic plants were performed.
F1 hybrid seeds were harvested, surface- sterilized and germinated on half strength MS basal medium in the dark at 25°C.
Germinated seedlings were transferred to greenhouse and maintained for further analysis.

44. Development of ASAL and cre lines
Eight reciprocal crosses were made between four T1ASAL positive plants of ASAL-lox-hpt-lox lines: LA2, LB9, LD3, LF5 and four T1cre positive plants of cre-bar lines: CA2, CC3, CD1, CE5.
Cross no.
T 1 parent
Hybrid line ID
Total plants
ASAL and cre positive plants
hpt negative plants
Recombination frequency (% ) ♂ ♀ 1
LA2
CC3
LA2CC3 30 16 9
56.25 2
LB9
CD1
LB9CD1 35 18 50 3
LD3
CA2
LD3CA2 25 15 7
46.67 4
LF5
CE5
LF5CE5 17 5
29.41
CA2LD3 40 22 10
45.5 6
CC3LA2
37.5
CD1LB9
22.2 8
CE5LF5 21
28.5
Crosses between ASAL and cre lines and estimation of the frequency of cre -mediated excision

45. Screening of transgenic plants by PCR
The analysis of T0, T1, F1 hybrid and F2 plants were carried out with the DNA extracted from mature leaf tissue of putative transformed plants as well as control plants.
(PCR) were performed in all lines using ASAL, hpt and cre specific forward and reverse primers.
Primers
Sequences
Annealing temperature (°C)
Amplicon size (bp)
A1 (ASAL forward)
5′ATGGCCAGGAACCTACTGACGA 3′ 56
362
B1 (ASAL reverse)
5′CTATCTTCTCTAGGTACCAGTA 3′
A2 (cre forward)
5′ ATGTCCAATTTACTGACC 3′ 58
1100
B2 (cre reverse)
5′ CTAATCGCCATCTTCCAGC 3′
A3 (hpt forward)
5′ GCTTTCCACTATCGGCGA 3′
980
B3 (hpt reverse)
5′ AAAGCCTGAACTCACCGC 3′

46. Molecular analysis of gene excision
Multiplex PCR was performed with ASAL and cre gene specific primers (Table 1).
Among the 30 progeny plants, 16 plants were found to be positive for both ASAL gene and cre gene; 8 for only ASAL gene, 4 plants only for cre gene and 2 plants were azygous for both the genes (Figure A).
The marker gene excision among the 16 ASAL and cre positive hybrid plants of LA2CC3 2, 3, 6, 7, 9, 12, 13, 14, 16, 18, 21, 23, 24, 27, 28, 29 were further verified through PCR (Figure B) using hpt gene specific primers.
This amplification identified nine hpt negative plants where cre did work efficiently; as a result excision of hpt took place through recombination event.
Following nine plants: LA2CC3 3, 6, 9, 12, 14, 18, 23, 24, 27 were found to be hpt negative.
Cre/lox mediated recombination frequency was 56.25% in case of hybrid line LA2CC3.

47. Molecular analysis of marker gene excision
A Multiplex PCR analysis of F1 hybrid line LA2CC3.
Lane '+’, mix of pBKhgASAL and pBK16.2 plasmids as positive control.
Lane '- ’ genomic DNA of an untransformed plant.
Lanes 1–30, 30 F1 hybrid progenies of line LA2CC3.
The 362 bp and 1.1 kb amplicon derives from the ASAL and cre genes respectively and 
B PCR with hpt specific primers of 16 ASAL+cre+plants of F1 hybrid line LA2CC3.
Lane ' + ', pBKhgASAL .
Lane ' – ', genomic DNA of an untransformed plant.
Lanes 1–16, F1 hybrid plants, where plant no. 3, 6, 9, 12, 14, 18, 23, 24 and 27 showed absence of hpt.
The 980 bp amplicon derives from the hpt gene. Lane M in A and B, DNA molecular weight marker.

48. Molecular analysis of gene excision
The nine hybrid plants were further verified through Southern blotting experiments using three different probes for ASAL, cre and hpt (Figure A,B,C)
Shows the absence of hpt gene (Figure C) but the presence of ASAL and cre genes (Figure A,B) in those nine hybrid plants.
Recombination frequency in another seven hybrid lines varied between %.

49. DNA from Gel blots were hybridized with probe for
Southern blot analysis of HindIII digested genomic DNA from nine hpt negative F1 hybrid lines
DNA from Gel blots were hybridized with probe for 
A 362 bp ASAL sequence 
B 1.1 kb cre sequence and 
C 980 bp hpt sequences.
Lane '+’ represents in 
A PCR amplifiedASAL gene, 
B PCR amplified cre gene, 
C PCR amplified hpt gene as positive control,
lane ' – ' represents HindIII digested genomic DNA from control plants as negative control.

50. Expression of ASAL in F1 hybrid lines
Nine hpt negative LA2CC3 F1 hybrid progeny plants were analyzed to monitor the expression of ASAL.
Western blot of total soluble protein extracted from 30 days old plants’ leaves of those nine lines showed identical signals at ~12 kDa region (Figure A), corresponding to the purified native ASAL protein when probed with anti- ASAL antibody.
ELISA was performed to quantify the level of expressed ASAL in the selected plants.
These nine plants showed level of expression of ASAL in the range of 0.2% to 0.48% of the total soluble protein (Figure 5B).

51. Expression of ASAL in F1 hybrid plants
A Western blot analysis of protein extracts from leaves of nine hpt –ve F1 hybrid mustard plants.
Lane 1, native ASAL used as positive control;
lane 2, crude protein from untransformed plant used as negative control;
lanes 3 – 11, show crude protein of LA2CC3 3, 6, 9, 12, 14, 18, 23, 24, 27 . 
B ELISA analysis for expression of ASAL in total soluble protein of those mentioned F1 hybrid lines respectively.

52. Hemagglutination assay of expressed ASAL protein from F1 hybrid plants
Hemagglutination assay was performed with the extracted total soluble protein from five F1 hybrid ASAL positive plants [LA2CC3 3, 9, 14, 18, 23].
A tight button of rabbit erythrocytes was formed indicating negative reaction in well no. 1 – no protein control and well no. 2 - containing protein samples of untransformed plants in panel I-V.
Five F1 hybrid lines exhibited agglutination of RBCs resulting in the formation of a layer over the wells (well no. 3–7; panel I-V) of the microtiter plate.
This result confirmed the retention of agglutination property in the transgenically expressed ASAL protein.

53. Thermal stability assay of expressed ASAL protein from F1 hybrid plants
The transgenically expressed ASAL protein was found to be stable up to 37°C, but loses its functionality when heated at °C
Rabbit erythrocytes incubated with total soluble protein from ASAL positive F1hybrid plants [LA2CC3 3, 9, 14, 18, 23 in panel I-V respectively] pre-incubated at different temperatures as- 4°C, 25°C, 37°C, 55°C, 75°C and 95°C in Panel I-V; wells 2–7 respectively.
Well 1 (I-V): No protein control (rabbit erythrocytes incubated without ASAL).

54. In planta insect bioassay
Effect of ASAL on survivability of  Lipaphis erysimi, in planta insect bioassay was carried out in bioassay cages over 9 days time period using five ASAL expressing hpt negative F1 hybrid plants of LA2CC3 line.
Inset in A shows Lipaphis erysimi culture on control mustard plant.
The survival of aphid was monitored with third instar nymphs at an interval of 24 h.

55. In planta insect bioassay
In C, percentage of survival of mustard aphid on untransformed control plant and five ASAL expressing F1 hybrid plants LA2CC3 3, 9, 14, 18, 23.
In D, fecundity pattern (mean number of nymphs produced per plant) of L. erysimi fed on control and five F1 hybrid plants- LA2CC3 3, 9, 14, 18, 23.
The number of nymphs produced per plant was reduced by approximately 41% – 59% compared to control plants.

56. Establishment of marker free F2 plants
Since the F1hpt negative hybrid plants are cre positive, it is very likely that they are also bar positive.
Some of the F1 progeny plants were allowed to self-fertilize to obtain F2 plants and analyzed for complete marker removal mediated by genetic segregation.
Ten F2 progeny plants of the hpt negative line LA2CC3 (3) were analyzed for the presence of ASAL, hpt and cre genes.
Three plants [F2 plant no. LA2CC3 (3) - 3, 6, 9] were found to contain only ASAL, one plant [no. LA2CC3 (3) – 8] showed the presence of only cre and six plants contained both ASAL and cre genes [no. LA2CC3 (3) – 1, 2, 4, 5, 7, 10].
Since the F1hpt negative hybrid plants are cre positive, it is very likely that they are also bar positive.
Ten randomly chosen seeds from LA2CC3(3) line were analysed through multiplex PCR using ASAL andcre gene specific primer pairs.
Lane 1–10 represents plant no. LA2CC3(3) 1–10 respectively,
Lane '+’ represents mix of pBKhgASAL and pBK16.2 plasmids as positive control and
Lane '-’ represents negative control (genomic DNA of untransformed plant);
Lane M, DNA molecular weight marker.

57. Summary
ASAL linked with lox flanked hygromycin resistant (hpt) gene was introduced in mustard.
Cre recombinase gene cassette was also integrated in separate event.
A Cre/lox mediated recombination using crossing strategy was adopted to remove the hpt gene from the subsequent generation of selected hybrid events.
Reciprocal crosses were made between T1ASAL-lox- hpt-lox and cre-bar plants.
Marker gene elimination was confirmed in the resulting F1 hybrid progenies by PCR analysis, using hpt, cre and ASAL specific primers followed by Southern hybridization.

58. Summary (cont.)
In marker free plants, expression of ASAL was also confirmed by western blotting and ELISA analysis.
Retention of functionality of expressed ASAL was investigated by agglutination assay using rabbit erythrocytes.
Expressed ASAL was also found to be thermo-sensitive.
In planta insect bioassay on F1 hybrid progenies exhibited detrimental effect on the performance of devastating target pest, Lipaphis erysimi.
The F1 hybrid hpt negative, ASAL positive plants were allowed to self- fertilize to obtain F2 progeny plants. In some of these plants cre gene was found to be segregated out of the ASAL gene by genetic segregation yielding completely marker free plants.