1. Copyright © 2009 Pearson Education, Inc. Active Lecture Questions for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Chapter 9 Patterns of Inheritance

2. Copyright © 2009 Pearson Education, Inc. Concept Check The figure diagrams one of the genetic crosses that helped Mendel form his theories of inheritance. Which process distributes “P” alleles to approximately one half of the F 1 gametes and the “p” allele to the other half? 1)Independent assortment. 2)Mitosis. 3)Meiosis. 4)Chromosome crossover.

3. Copyright © 2009 Pearson Education, Inc. Answer The figure diagrams one of the genetic crosses that helped Mendel form his theories of inheritance. Which process distributes “P” alleles to approximately one half of the F 1 gametes and the “p” allele to the other half? 3)Meiosis.

4. Copyright © 2009 Pearson Education, Inc. Why did the F ₁ offspring of Mendel's classic pea cross always look like one of the two parental varieties? A) No genes interacted to produce the parental phenotype. B) Each allele affected phenotypic expression. C) The traits blended together during fertilization. D) One phenotype was completely dominant over another. E) Different genes interacted to produce the parental phenotype. D) One phenotype was completely dominant over another.

5. Copyright © 2009 Pearson Education, Inc. Concept Check Mendel’s principle of independent assortment holds true only for traits with genes that 1)are on homologous chromosome (linked). 2)are on separate chromosomes (unlinked). 3)have loci very far apart on homologous chromosomes. 4)are both “2” and “3”.

6. Copyright © 2009 Pearson Education, Inc. Answer Mendel’s principle of independent assortment holds true only for traits with genes that 4)are both “2” and “3”.

7. Copyright © 2009 Pearson Education, Inc. Concept Check The traits studied by Mendel were mostly discrete traits with two phenotypes. Many traits such as human height vary continuously. Which of the following describe the inheritance of continuously varying traits using Mendel’s rules of inheritance? 1)Two or more genes interact to produce the variation in the trait apparent in the population of the organism. 2)Two or more alleles interact to produce the variation in the trait apparent in the population of the organism. 3)Mendel’s principles do not apply to continuously varying traits. 4)Traits with continuous variability are not influenced by heredity.

8. Copyright © 2009 Pearson Education, Inc. Answer The traits studied by Mendel were mostly discrete traits with two phenotypes. Many traits such as human height vary continuously. Which of the following describe the inheritance of continuously varying traits using Mendel’s rules of inheritance? 1)Two or more genes interact to produce the variation in the trait apparent in the population of the organism.

9. Copyright © 2009 Pearson Education, Inc. Interpreting Data The students decided to carry out the investigation for one more generation. Again, they selected the top 15% of the hairy plants as parents Which of the following results would be consistent with the hypothesis that the inheritance of trichomes is polygenic? 1)The distribution and mean number of hairs continues to shift to the right. 2)The distribution narrows but the mean does not shift. 3)The distribution curve spreads out but mean does not shift.

10. Copyright © 2009 Pearson Education, Inc. Answer The students decided to carry out the investigation for one more generation. Again, they selected the top 15% of the hairy plants as parents Which of the following results would be consistent with the hypothesis that the inheritance of trichomes is polygenic? 1)The distribution and mean number of hairs continues to shift to the right.

11. Copyright © 2009 Pearson Education, Inc. The monomers of DNA and RNA are A) nucleotides. B) nucleic acids. C) monosaccharides. D) fatty acids. A) nucleotides.

12. Copyright © 2009 Pearson Education, Inc. What nucleotide sequence would be found on the partner DNA strand of the strand shown? ACTGT A) TGACA B) TGUGU C) UGAGA D) ACTGT A) TGACA

13. Copyright © 2009 Pearson Education, Inc. During replication, the original "parent" DNA _____. A) is converted to RNA B) is incorporated into the new DNA strand C) is broken down as a new DNA strand forms D) serves as the template for the creation of two complete sets of DNA D) serves as the template for the creation of two complete sets of DNA

14. Copyright © 2009 Pearson Education, Inc. Which of the following enzymes catalyzes the elongation of a new DNA strand? A) helicase B) DNA polymerase C) ligase D) single-stranded binding protein B) DNA polymerase

15. Copyright © 2009 Pearson Education, Inc. Golden rice is golden in color because it is rich in A) vitamin C. B) beta-carotene. C) vitamin A. D) chromium picolinate. B) beta-carotene.

16. Copyright © 2009 Pearson Education, Inc. The transfer of genetic information from DNA to RNA is called A) translation. B) initiation. C) elongation. D) transcription. D) transcription.

17. Copyright © 2009 Pearson Education, Inc. The directions for each amino acid in a polypeptide are indicated by a codon that consists of ________ nucleotide(s) in an RNA molecule. Hold up # discreetly

18. Copyright © 2009 Pearson Education, Inc. Which of the following would indicate a base pairing mutation in DNA? A) an A paired with a T B) a C paired with a G C) a G paired with a T D) all of the above are improper base pairs C) a G paired with a T

19. Copyright © 2009 Pearson Education, Inc. Which of the following is an example of a transgenic organism? A) a bacterium with human gene for producing insulin B) Dolly, the cloned sheep C) a bacterium found with a plasmid that provides protection against an antibiotic D) a "test-tube" baby produced via in vitro fertilization A) a bacterium with human gene for producing insulin

20. Copyright © 2009 Pearson Education, Inc. Restriction enzymes __________________________. A) bind DNA together at specific nucleotide sequences B) cut DNA at specific nucleotide sequences C) restrict access to the DNA of a cell D) copy DNA B) cut DNA at specific nucleotide sequences

21. Copyright © 2009 Pearson Education, Inc. The process of accurately amplifying a sample of DNA is called __________________________. A) the polymerase chain reaction B) recombinant DNA C) short tandem repeats D) gel electrophoresis A) the polymerase chain reaction

22. Copyright © 2009 Pearson Education, Inc. Gel electrophoresis separates pieces of DNA based on _________. A) charge B) size C) sequence D) quantity B) size

23. Copyright © 2009 Pearson Education, Inc. When DNA from two sources is combined into one single piece of DNA, it is known as A) cloned DNA. B) a plasmid. C) a vector. D) recombinant DNA. D) recombinant DNA.

24. Copyright © 2009 Pearson Education, Inc. DNA ligase binds A) nucleotides together. B) polymerase to the promotor. C) exons together. D) an intron to an exon. A) nucleotides together.

25. Copyright © 2009 Pearson Education, Inc. The unpaired nucleotides produced by the action of restriction enzymes are referred to as _____. A) sticky ends B) base sequences C) single strands D) restriction fragments E) ligases A) sticky ends

26. Copyright © 2009 Pearson Education, Inc. The sticky end of the DNA restriction fragment shown here (TGCA) will pair with a DNA restriction fragment with the sticky end _____. A) -ACGT B) -AAAA C) -ACGU D) -GTAC E) -TGCA A) -ACGT

27. Copyright © 2009 Pearson Education, Inc. Which of the following restriction enzymes cuts the following DNA? Assume that ^ determines the cut site. GCATTACGGGATCCACCCGTT A) Alu (AG^CT) B) EcoRI (G^AATTC) C) BamHI (G^GATCC) D) HindIII (A^AGCTT) C) BamHI (G^GATCC)

28. Copyright © 2009 Pearson Education, Inc. The enzyme that converts information stored in their RNA to information stored in DNA is A) a restriction enzyme. B) DNA ligase. C) RNA polymerase. D) reverse transcriptase. D) reverse transcriptase.