1. Genetic Engineering and Biotechnology

2. I.Cell cloning 1997: ________ the sheep.

3. I.Cell cloning 1997: Dolly the sheep.

4. I.Cell cloning 1997: Dolly the sheep. Scotland

5. I.Cell cloning 1997: Dolly the sheep. Scotland Significance: Scientists had never been able to stimulate a cell to develop into an embryo.

6. sperm Egg Genetic material from the two parent sheep removed Dolly’s liver DNA replaces egg DNA #1 Sperm & Egg Combined #2 #3 #4 Altered egg zapped with electricity #5 Embryo placed into surrogate mother

7. Another cloning method – more frequently used now.

8. II. Gene Sequencing Determining the order (sequence) of ________ in DNA. This is called our _________.

9. II. Gene Sequencing Determining the order (sequence) of bases/nucleotides in DNA. This is called our genome. The Human Genome Project: started in 1990. Goal: to determine the human base sequence. “Rough Draft”: Summer of 2000. Benefit: If we know what the “normal” genotype looks like, then we can identify defective genes.

10. III. Gene manipulation Combined DNA from two different organisms: called ___________ ______.

11. III. Gene manipulation Combined DNA from two different organisms: called recombinant DNA. (Glow-in-the dark bacteria; insulin- producing bacteria; vitamin-producing rice) Adding synthetic chromosomes to embryos Genetic profiling of embryos

13. IV. Forensics/Identification Using our “junk DNA” to solve crimes. Paternity testing. How our DNA is used: **Everyone carries repeat sequences, called RFLPs/ (restriction fragment length polymorphisms) between certain genes. While the order of bases in these sequences does not vary between people, the number of repeats does. Person #1 Gene 9 ATTATTATTATTGene 10 (12 bps) Person #2Gene 9 ATTATTATTATTATTATTGene 10 (18 bps) Restriction Enzymes

14. Gel Electrophoresis: Separation of DNA fragments using electricity. (-)Well (+) Repeat Sequence from Person #1: _______ Repeat Sequence from Person #2: ____________ Gel

15. Gel Electrophoresis: Separation of DNA fragments using electricity. (-) (+) Repeat Sequence from Person #1: _______ Repeat Sequence from Person #2: ____________ **Shorter fragments travel further than longer fragments!! 18 12

17. V. Gene Splicing: DNA fragments are created by ___________ _________.

18. V. Gene Splicing: DNA fragments are created by Restriction Enzymes. Restriction enzymes leave “sticky” ends: AGCTTATTACCCTGACCTGTA ATAATGGGACTGGACATTCGA AGCTTATTACCCTGACCTA ATAATGGGACTGGATTCGA Sticky End

19. DNA “fragments” with the same “sticky ends” can potentially recombine (i.e. jellyfish gene and E. coli plasmid DNA)

20. VI. Biological Weapons Creating a “super bug” (virus or bacteria) with a recombination of genes (flu virus + ebola) Anthrax scare after 9/11 Smallpox eradication “The Cobra Event” by Richard Preston Fleas as Vectors Anthrax

21. VII. Practical Applications 1.Medical Use: ID “diseased genes” – embryo selection (PGD) or early diagnosis for children/adults (i.e. cancer genes) DNA Master Chip

22. 2. Pharmaceutical Products Human insulin Human growth hormone Spider silk and goats (“pharm” animals) 3. Forensics DNA fingerprints Paternity testing Genetic testing to establish heritage

23. 4. Environmental Advantages: Genetically modified microbes (bacteria that clean up oil spills and other waste) Saving endangered species/Resurrecting extinct species

24. 5. Agriculture Transgenic animals (sheep with better wool, cows producing more milk/reach maturity quicker, leaner meat, etc.) Cloning livestock (bulls, cows, race horses, etc.) Plants: Mature plants can be grown from a single cell – cell can take in a bacterial plasmid containing the gene of interest. (Herbicide resistance, pest resistance, nutrition: g.m. rice making beta carotene – Vit A – eyesight) Normal Rice Golden Rice

25. Super cow: 3 times normal size, no fat, lots of milk!

26. Belgian Blue Cattle: Famous for their double muscling due to a gene that suppresses the production of Myostatin. This breed produces extraordinary amounts of meat but critics call Belgian blues ‘monster cows’ and some countries have advocated to eliminate the strain.

27. Glow-in-the-Dark Mice

29. Antifreeze gene added from Arctic flounder fish – freezing strawberries & still fresh!