1. Inheritance Patterns and Human Genetics http://worms.zoology.wisc.edu/zooweb/Phelps/karyo.jpeg

2. 1.Sex chromosomes 2.Autosomes 3.Sex-linked trait 4.Linked gene 5.Chromosome map 6.Map unit 7.Deletion 8.Inversion 9.Translocation 10.Nondisjunction 11.Substitution A.Trait coded for by an allele on a sex chromosome B.The X and Y chromosomes C.Diagram that shows the order of genes on a chromosome D. Pairs of genes that are inherited together E.All chromosomes except the X and Y F.Type of mutation where one nucleotide replaces another G. Chromosome piece breaks off, flips and reattaches H. Chromosomes fail to separate from their matching partner I. A piece of one chromosome breaks off and attaches to another J.1% frequency of cross-over in a chromosome K. Loss of a piece of chromosome due to breakage

3. 12.Germ-cell mutation 13.Somatic-cell mutation 14.Lethal mutation 15.Point mutation 16.Frameshift mutation 17.Insertion mutation L. Genetic mutation that causes death M. Genetic mutation in a body cell N. Genetic mutation in a gamete cell O. Mutation in which nucleotides are added to a gene P. Any mutation that affects the order and grouping of all nucleotide bases that occur after the mutation Q. Any mutation that occurs in a single gene

4. 1.Sex chromosomesB 2.AutosomesE 3.Sex-linked traitA 4.Linked geneD 5.Chromosome mapC 6.Map unitJ 7.DeletionK 8.InversionG 9.TranslocationI 10.NondisjunctionH 11.SubstitutionF 12.Germ-cell mutationN 13.Somatic-cell mutationM 14.Lethal mutationL 15.Point shift mutationQ 16.Frameshift mutationP 17.Insertion mutationO

5.  To understand human genetics, we must first understand chromosomes.  Chromosomes are structures made of DNA and proteins that carry heredity information and direct the activities of cells.  Humans have 23 matching pairs of chromosomes (46 total) http://www.internetphotos.net/wp-content/uploads/2008/08/human-chromosome.jpg

6.  Thomas Hunt Morgan discovered that one pair of chromosomes determines the sex of an animal while studying fruit flies.  Called the X and Y chromosomes, or sex chromosomes.  XX = female  XY = male http://nuclearfamilywarhead.com/wp-content/uploads/2008/04/chromosomes.jpg Charts that show and individual’s full set of chromosomes are called karyotypes

7.  The other chromosomes are known as autosomes.  The sex chromosomes separate along with the other 22 pairs of chromosomes when sperm and egg cells form during meiosis.  Therefore, each egg cell contains an X chromosome.  Sperm cells can contain an X or a Y.  So, it is the father that determines the sex of the child. http://www.zuniv.net/physiology/book/images/29-1.jpg

8.  The Y chromosome contains a gene called SRY (Sex-determining Region Y). It produces a protein that causes the development of testes. Without this protein, reproductive organs will develop into ovaries. http://www.nature.com/scitable/nated/content/18935/pierce_4_10_mid_1.jpg

9.  During Morgan’s experiments he discovered something odd. Examine the diagram and try to figure out what’s going on???  Crossing a red eyed fly with a white eyed fly produces all red eyed flies.  What does this tell us about the genes for red and white eyes??  If white is recessive, then we should get ¼ white eyes in the second generation—and we do!!  But…..they are all males!!!! Why???  Answer: Sex-Linked Traits http://knight.noble-hs.sad60.k12.me.us/content/exploringLife/text/chapter10/10images/10-16.gif

10.  Sex-linked traits are traits that are carried on a sex chromosome  Morgan called sex-linked traits:  X-linked (carried on the X chromosome)  Y-linked (carried on the Y chromosome)  Most are carried on the X chromosome and are therefore more common in males.  This is because the matching information on the Y chromosome is missing.  Examples: Color-blindness and Hemophilia

11. Normal woman marries a color blind man X XcYXcY XcXXcX XcXXcX XY There is no chance any of their children will be colorblind. However, any girl they have will be a carrier. (Carrier = carries genetic information without showing the trait) XX x X c Y

12.  Once again, Morgan discovered something odd while studying his fruit flies.  He found two dominant genes (gray body and long wings) did not assort independently as predicted in Mendel’s pea plant experiments.  What’s going on???  Answer: Linked Genes  These genes are carried on the same chromosome GgLl X GgLl Result: 3 Gray, long wings : 1 black, short wings RrYy X RrYy Result: 9:3:3:1 9 round/yellow 3 round/ green 3 wrinkled/yellow 1 wrinkled/green

13.  Chromosome map — diagram that shows the linear order of genes on a chromosome.  Developed by using the results of breeding experiments and by looking for the percentage of crossing-over for two traits.  The higher the percentage of crossing-over, the farther away two genes are on a chromosome  Map unit —frequency of 1% cross over

14.  Mutation—a change in the nucleotide-base sequence of a gene or DNA molecule.  Types:  Germ-cell mutation —occur in gametes/do not affect the organisms/can be inherited  Somatic-cell mutation —occur in body cells/do affect the organisms/can not be inherited  Lethal mutations —cause death, usually before birth  Beneficial mutations —improve chance of survival/provide variation in natural selection

15.  Mutations that involve an entire chromosome  Types:  Deletion—loss of a piece of chromosome due to breakage  Translocation—part of a chromosome breaks off and attaches to another chromosome  Inversion—part of a chromosome breaks off, flips, and reattaches  Nondisjuction—a chromosome fails to separate from its partner during meiosis http://www.montana.edu/wwwai/imsd/diabetes/mutation.gif

16.  Point mutation —change that occurs within a single gene  Types: Substitution, Deletion, or Insertion  Substitution—one nucleotide replaces another/result in the production of a different amino acid  Deletions and Insertions do not always result in point mutations. More commonly, they result in Frameshift Mutatons. CTTCTT DNA mRNA Amino acid GAAGAA Glutamic acid CATCAT GUAGUA Valine

17.  Frameshift mutation — results after a deletion has occurred. All remaining codons are incorrectly grouped affecting all remaining amino acids. This can seriously damage the protein.  Can also occur after an insertion of one or more extra nucleotides occurs. DNA mRNA Amino acid ACGCTCGTCTACGCTCGTCT ACCTCGTCTACCTCGTCT UGCGAGCAGAUGCGAGCAGA UGGAGCAGAUGGAGCAGA Cysteine Glutamic acid Glutamine Tryptophan Serine Arginine Deleted

18. 1.Pedigree 2.Carrier 3.Genetic disorder 4.Polygenic 5.Complex character 6.Multiple allele 7.Codominance 8.Incomplete dominance 9.Sex-influenced trait 10.Amniocentesis 11.Chronic villi sampling 12.Genetic counseling 13.Gene therapy A.Characters influenced by both genes and environment B.Characteristics influenced by many genes C.More than two alleles exist for a trait D.Way of detecting genetic disorders by extracting amniotic fluid E.Intermediate traits (blending of two) F.Way of detecting genetic disorders by testing special cells derived from the zygote G.Both alleles for a trait are expressed H.Disabling conditions with a genetic basis I.Diagram that shows inherited traits through several generations J.Have a recessive allele for a trait but do not show the trait K.Informing a person of their genetic makeup L.Healthy genes replace defective genes M.Male pattern baldness

19. 1.PedigreeI 2.CarrierJ 3.Genetic disorderH 4.PolygenicB 5.Complex characterA 6.Multiple alleleC 7.CodominanceG 8.Incomplete dominanceE 9.Sex-influenced traitN 10.AmniocentesisD 11.Chronic villi samplingF 12.Genetic counselingK 13.Gene therapyL

20.  Pedigree —diagram that shows how a trait is inherited over generations.  Can be used to trace the occurrence of diseases as well. =male w/ trait =female w/ trait = carrier

22. Sex-linked

23.  Polygenic Inheritance —many genes control a single trait. Examples: hair, eye and skin color, height, and fingerprint patterns

24.  Complex characters —characters that are influenced strongly both by the environment and by genes  Ex: skin color—both genetic and exposure to sun  Height and weight—both genetic and diet or disease  Some cancers http://anthro.palomar.edu/adapt/images/skin_color_range.jpg

25.  Multiple alleles —more that two alleles exist for a trait in the population. You still inherit only two—one from mom and one from dad.  Ex: Blood type (Three alleles: I A, I B and i; produce four blood types: A, B, AB, and O)  I A and I B are codominant (both expressed in the phenotype)  i is recessive http://library.thinkquest.org/05aug/01576/images/bloodtypes.pnghttp://www.buzzle.com/images/blood-types/blood-types-chart.png

26.  Try to figure out the missing blood types. How many can you determine for sure?

27.  Sex-influenced traits —males and females have the same genotype but different phenotypes  Ex: Male pattern baldness: The allele is dominant in men but recessive in women due to different levels of testosterone http://hairimplantsformen.com/pictures/male-pattern-baldness.jpg

29.  Genetic screening —examination of a person’s genetic makeup. Includes: karyotypes, blood tests for proteins or DNA tests  Genetic screening can be done even before birth:  Amniocentesis —test of amniotic fluid  Chorionic villi sampling —test of cells, derived from the zygote, that grow between the uterus and the placenta  Over 200 genetic disorders can be detected in a fetus using these techniques Chorionic villi sampling Amniotic fluid sample

30.  Genetic Counseling —medical guidance sought to determine the likelihood of passing on a genetic disorder to a child. Treating genetic diseases is difficult. Usually, we can only treat symptoms.  Gene Therapy is currently being studied as a way to cure genetic diseases like Cystic Fibrosis. It has only been somewhat successful in animal studies.  Remove DNA core from a virus  Inject good genetic material into the virus  Allow virus to deliver the healthy DNA to cells