UK MRC Human Genome Mapping Project Resource Centre EMBOSS – an application suite for bioinformatics Lisa Mullan.

Slides:

Advertisements

Similar presentations

Blast outputoutput. How to measure the similarity between two sequences Q: which one is a better match to the query ? Query: M A T W L Seq_A: M A T P.

Advertisements

CSCE555 Bioinformatics Lecture 3 Gene Finding Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:

EMBOSS – an application suite for Bioinformatics  Shahid Manzoor  Adnan Niazi SLU Global Bioinformatics Centre.

Alignment methods Introduction to global and local sequence alignment methods Global : Needleman-Wunch Local : Smith-Waterman Database Search BLAST FASTA.

Sources Page & Holmes Vladimir Likic presentation: 20show.pdf

NCBI data, sliding window programs and dot plots Sept. 25, 2012 Learning objectives-Become familiar with OMIM and PubMed. Understand the difference between.

EMBOSS GUI 2k EMBOSS

Sequence Alignment.

Lecture 8 Alignment of pairs of sequence Local and global alignment

Sequence Similarity Searching Class 4 March 2010.

Sequence Analysis MUPGRET June workshops. Today What can you do with the sequence? What can you do with the ESTs? The case of SNP and Indel.

Introduction to Bioinformatics Algorithms Sequence Alignment.

Problem 1 DNA Polymerase – a protein complex that copies DNA to DNA RNA Polymerase – a protein complex that copies DNA to RNA Spliceosome – a protein/RNA.

Sequence analysis using EMBOSS & wEMBOSS by Martin Sarachu Based on the EMBOSS tutorial, by Nikos Drakos, Val Curwen, David Martin, Gary Williams and many.

Introduction to Bioinformatics - Tutorial no. 2 Global Alignment Local Alignment FASTA BLAST.

Sequence Comparison Intragenic - self to self. -find internal repeating units. Intergenic -compare two different sequences. Dotplot - visual alignment.

Sequence similarity.

Alignment methods June 26, 2007 Learning objectives- Understand how Global alignment program works. Understand how Local alignment program works.

Review of Laboratory 3 Spectrophotometric determination of DNA quantity, purity Abs 260 nmAbs 280 nmAbs 320 nmAbs 260/Abs

Sequence Alignment III CIS 667 February 10, 2004.

Introduction to Bioinformatics Algorithms Sequence Alignment.

Bioinformatics Unit 1: Data Bases and Alignments Lecture 3: “Homology” Searches and Sequence Alignments (cont.) The Mechanics of Alignments.

Alignment methods II April 24, 2007 Learning objectives- 1) Understand how Global alignment program works using the longest common subsequence method.

Pairwise Sequence Alignment (PSA)

Sequence comparison: Local alignment

Assessment of sequence alignment Lecture Introduction The Dot plot Matrix visualisation matching tool: – Basics of Dot plot – Examples of Dot plot.

Pairwise Alignment How do we tell whether two sequences are similar? BIO520 BioinformaticsJim Lund Assigned reading: Ch , Ch 5.1, get what you can.

© Wiley Publishing All Rights Reserved.

Analysis of single sequences. Toolboxes EMBOSS –Many portals. (E.g)E.g Biology Workbench ExPasy proteomics tools U. Mass. Med. School.Biotools.

Assessment of sequence alignment Lecture Introduction The Dot plot Matrix visualisation matching tool: – Basics of Dot plot – Examples of Dot plot.

An Introduction to Bioinformatics

Protein Sequence Alignment and Database Searching.

Computational Biology, Part 3 Sequence Alignment Robert F. Murphy Copyright  1996, All rights reserved.

Sequence Alignment Techniques. In this presentation…… Part 1 – Searching for Sequence Similarity Part 2 – Multiple Sequence Alignment.

Basic Overview of Bioinformatics Tools and Biocomputing Applications I Dr Tan Tin Wee Director Bioinformatics Centre.

Pairwise alignment of DNA/protein sequences I519 Introduction to Bioinformatics, Fall 2012.

CISC667, F05, Lec9, Liao CISC 667 Intro to Bioinformatics (Fall 2005) Sequence Database search Heuristic algorithms –FASTA –BLAST –PSI-BLAST.

Construction of Substitution Matrices

Function preserves sequences Christophe Roos - MediCel ltd Similarity is a tool in understanding the information in a sequence.

REMINDERS 2 nd Exam on Nov.17 Coverage: Central Dogma of DNA Replication Transcription Translation Cell structure and function Recombinant DNA technology.

Basic terms:  Similarity - measurable quantity. Similarity- applied to proteins using concept of conservative substitutions Similarity- applied to proteins.

Comparing Sequences AND Multiple Sequence Alignment Bioinformatics

Pattern Matching Rhys Price Jones Anne R. Haake. What is pattern matching? Pattern matching is the procedure of scanning a nucleic acid or protein sequence.

LiveBASE, the Bioinformatics Application SuitE. Introduction: Mission Statement Leading Provider of Business Process Integration Solutions for Life Science.

Motif discovery and Protein Databases Tutorial 5.

BIOLOGICAL DATABASES. BIOLOGICAL DATA Bioinformatics is the science of Storing, Extracting, Organizing, Analyzing, and Interpreting information in biological.

Applied Bioinformatics Week 3. Theory I Similarity Dot plot.

Biocomputation: Comparative Genomics Tanya Talkar Lolly Kruse Colleen O’Rourke.

Sequence Alignments with Indels Evolution produces insertions and deletions (indels) – In addition to substitutions Good example: MHHNALQRRTVWVNAY MHHALQRRTVWVNAY-

Basic Overview of Bioinformatics Tools and Biocomputing Applications II Dr Tan Tin Wee Director Bioinformatics Centre.

Sequence Based Analysis Tutorial March 26, 2004 NIH Proteomics Workshop Lai-Su L. Yeh, Ph.D. Protein Science Team Lead Protein Information Resource at.

Sequence Alignment.

David Wishart February 18th, 2004 Lecture 3 BLAST (c) 2004 CGDN.

Performing BlastP Amino acids Based on the nature of the side chains:  Aliphatic amino acids- G, A, V, L, I, P  Aromatic amino acids- F, Y, W  Polar.

What is sequencing? Video: WlxM (Illumina video) WlxM.

Techniques for Protein Sequence Alignment and Database Searching G P S Raghava Scientist & Head Bioinformatics Centre, Institute of Microbial Technology,

Pairwise Sequence Alignment

July LJM Introduction to Bioinformatics Lisa Mullan, HGMP-RC.

Bioinformatics Overview

Scoring Sequence Alignments Calculating E

Basics of BLAST Basic BLAST Search - What is BLAST?

Sequence comparison: Local alignment

Biology 162 Computational Genetics Todd Vision Fall Aug 2004

Genome organization and Bioinformatics

Sequence Based Analysis Tutorial

Pairwise Sequence Alignment

Basic Local Alignment Search Tool

Introduction to bioinformatics Lecture 5 Pair-wise sequence alignment

It is the presentation about the overview of DOT MATRIX and GAP PENALITY..

Presentation transcript:

UK MRC Human Genome Mapping Project Resource Centre EMBOSS – an application suite for bioinformatics Lisa Mullan

UK MRC Human Genome Mapping Project Resource Centre E – European M – Molecular B – Biology O – Open S – Software S - Suite

UK MRC Human Genome Mapping Project Resource Centre Large collection of gene and protein analysis tools Sequence retrieval Alignments Primer design Restriction Mapping Protein domain searching Translation

UK MRC Human Genome Mapping Project Resource Centre DNA Sequence 1 DNA Sequence 2 dotplottranslation protein local/global alignment protein Sequence 1 protein Sequence 2 multiple sequence alignment motif and domain searching physicochemical properties

UK MRC Human Genome Mapping Project Resource Centre AGTGGTCGTGAAG AGAATGCTCCTCC TTTGGAATCTTAA >SEQ1.fasta AGTGCTCCTCCCT TAGAATCTTAG >SEQ2.fasta Unix% dottup SEQ1.fasta SEQ2.fasta –window 10 & Unix% dotmatcher SEQ1.fasta SEQ2.fasta –window 10 – threshold 17 & For an exact match: For a similarity match: Dotplots

UK MRC Human Genome Mapping Project Resource Centre ATGGGTCGTGAAGAGAATGCTCCTCCTTTGGAATCT TCTAAGATTCCCTCCTCGGTATCTAAGATTCCCTCCTCGGTA Dottup looks for regions of exact match Dotplots

UK MRC Human Genome Mapping Project Resource Centre ATGGGTCGTGAAGAGAATGCTCCTCCTTTGGAATCT TCTAAGATTCCCTCCTCGGTATCTAAGATTCCCTCCTCGGTA Dottup looks for regions of exact match There are no regions of exact match spanning a window size of between the vertical window of 10 and the horizontal sequence, therefore nothing is placed on the output graph. Dotplots

UK MRC Human Genome Mapping Project Resource Centre ATGGGTCGTGAAGAGAATGCTCCTCCTTTGGAATCT TCTAAGATTCCCTCCTCGGTATCTAAGATTCCCTCCTCGGTA There are no regions of exact match spanning a window size of 10 anywhere between the two sequences, therefore nothing is placed on the output graph. Dotplots

UK MRC Human Genome Mapping Project Resource Centre A T G C A T G – C Identity Matrix Dotplots

UK MRC Human Genome Mapping Project Resource Centre A T G C A T G – C CCTCCTTTGG Score = CCTCCTTTGG CCTCCCTTAG Score = 32 ProLeu ProLeu Dotplots

UK MRC Human Genome Mapping Project Resource Centre ATGGGTCGTGAAGAGAATGCTCCTCCTTTGGAATCT TCTAAGATTCCCTCCTCGGTATCTAAGATTCCCTCCTCGGTA Using a window size of 10 and a threshold value of 25 Dotplots

UK MRC Human Genome Mapping Project Resource Centre ATGGGTCGTGAAGAGAATGCTCCTCCTTTGGAATCT TCTAAGATTCCCTCCTCGGTATCTAAGATTCCCTCCTCGGTA Using a window size of 10 and a threshold value of 35 Dotplots

UK MRC Human Genome Mapping Project Resource Centre ATGGGTCGTGAAG AGAATGCTCCTCC TTTGGAATCTTAA >SEQ1.fasta ATGGCTCCTCCCT TAGAATCTTAG >SEQ2.fasta Unix% plotorf SEQ1.fasta –stop TAA, TAG –out GA.plot & Unix% getorf SEQ1.fasta –minsize 5 –table 0 –find 1 –out GA.getorf &

UK MRC Human Genome Mapping Project Resource Centre ATGGGTCGTGAAGAGAATGCTCCTCCTTTGGAATCTTAA TACCCAGCACTTCTCTTACGAGGAGGAAACCTTAGAATT Frame -3 Frame -2 Frame -1 Frame 1 Frame 2 Frame 3 Start and stop codons are located according to the instructions to the program, and the area in between start and stop codons

UK MRC Human Genome Mapping Project Resource Centre Indication of full coding sequence? Alternative splice form?

UK MRC Human Genome Mapping Project Resource Centre >_1 [ ] MLLLWNL >_2 [1 - 36] MGREENAPPLES* Using getorf: (min ORF size = 5) stop codon start methionine

UK MRC Human Genome Mapping Project Resource Centre Unix% transeq SEQ1.fasta –frame 1 –table 0 –sbegin 4 –send 33 -out GA.fasta & >_1 [ ] MLLLWNL >_2 [1 - 36] MGREENAPPLES* >GA.fasta GREENAPPLES Knowledge procured from the literature suggests that this protein is post-translationally modified to cleave the initial methionine residue

UK MRC Human Genome Mapping Project Resource Centre Unix% needle GA.fasta A.fasta –gapopen 10 –gapextend 0.5 –matrix EPAM250 & Unix% water GA.fasta A.fasta –gapopen 10 –gapextend 0.5 –matrix EPAM250 & >GA.fasta GREENAPPLES >A.fasta APPLES For a global alignment: For a local alignment: Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R APPESGREENL S E L P A P Gap Open Penalty = 10 Gap Extension Penalty = Using PAM250 matrix Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R APPESGREENL S E L P A P Gap Open Penalty = 10 Gap Extension Penalty = 0.5 Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R APPESGREENL S E L P A P Gap Open Penalty = 10 Gap Extension Penalty = Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R APPESGREENL S E L P A P Gap Open Penalty = 10 Gap Extension Penalty = Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R APPESGREENL S E L P A P Gap Open Penalty = 10 Gap Extension Penalty = Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R APPESGREENL S E L P A P Gap Open Penalty = 10 Gap Extension Penalty = Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R APPESGREENL S E L P A P Gap Open Penalty = 10 Gap Extension Penalty = Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R APPESGREENL S E L P A P Gap Open Penalty = 10 Gap Extension Penalty = Alignments

UK MRC Human Genome Mapping Project Resource Centre P S T W Y V B Z X A R N D C Q E G H I L K M F P S T W V B Z X Y A N D C Q E G H I L K M F R Gap Open Penalty = 10 Gap Extension Penalty = 0.5 APPESGREENL S E L P A P Alignments

UK MRC Human Genome Mapping Project Resource Centre Alignments To align two or more sequences in a biologically significant way. GREENAPPLES APPLES Local (water) Global (needle) Gap penalty = 10; Extension penalty = 0.5 APPLES

UK MRC Human Genome Mapping Project Resource Centre GREENAPPLES APPLES looks like the “apples” motif may be part of a larger domain APPLES physicochemical properties pattern searching

UK MRC Human Genome Mapping Project Resource Centre Physico- chemical properties Unix% iep GA.fasta –plot -step 0.5 –out GA.IEP & Unix% pepinfo GA.fasta –hwindow 8 –generalplot –hydropathyplot & Isoelectric point General properties

UK MRC Human Genome Mapping Project Resource Centre Physico- chemical properties D Y FW H K R E Q N M A G C S P I V L T Aliphatic Aromatic Hydrophobic Tiny Small Charged Positive Polar The pepinfo graph of properties is based on this diagram

UK MRC Human Genome Mapping Project Resource Centre Physico- chemical properties non-polar region with small residues polar region to one side of non- charged region

UK MRC Human Genome Mapping Project Resource Centre Hydropathy plot I 4.50 C 2.50 A 1.80 M 1.90 R-4.50 K-3.90 D-3.50 Q-3.50 N-3.50 E-3.50 H-3.20 S-0.80 T-0.70 P Y G W L 3.80 V 4.20 F 2.80 Kyte & Doolittle GREENAPPLES window size = = hydropathy value = -3.08

UK MRC Human Genome Mapping Project Resource Centre GREENAPPLES 0 Hydropathy plot GREEN REENA EENAP ENAPP NAPPL PPLES APPLE no truly hydropathic regions window size = 5

UK MRC Human Genome Mapping Project Resource Centre Pattern searching GREENAPPL---ES -RE-DAPPL---ES GREEN---LEAVES -RE-D---LEAVES GREENAPPLES >GA.fasta GREENLEAVES >GL.fasta REDAPPLES >RA.fasta REDLEAVES >RL.fasta [G] (0,1)-R–[E] (1,2)–[ND]–X (3)–L–X (3) – E – S

UK MRC Human Genome Mapping Project Resource Centre Pattern searching Unix% fuzzpro sptr:* pattern.fruit –mismatch 0 –out GA.fuzzpro & Search a protein database: [G] (0,1) - [R] – [E] (1,2) – [ND] –x (3) – [L] –x (3) – [E] – [S] pattern.fruit Nothing resembling this pattern is found in the database - But we could try scanning PRINTS (pscan) and PROSTIE (patmatmotifs) with one of our sequences.