The my Grid Information Model Nick Sharman, Nedim Alpdemir, Justin Ferris, Mark Greenwood, Peter Li, Chris Wroe AHM2004, 1 September 2004 www.mygrid.org.uk.

Slides:

Advertisements

Similar presentations

GRADD: Scientific Workflows. Scientific Workflow E. Science laboris Workflows are the new rock and roll of eScience Machinery for coordinating the execution.

Advertisements

OMII-UK Steven Newhouse, Director. © 2 OMII-UK aims to provide software and support to enable a sustained future for the UK e-Science community and its.

Data Access & Integration in the ISPIDER Proteomics Grid N. Martin – A. Poulovassilis – L. Zamboulis

Data Access & Integration in the ISPIDER Proteomics Grid L. Zamboulis, H. Fan, K. Bellhajjame, J. Siepen, A. Jones, N. Martin, A. Poulovassilis, S. Hubbard,

Principles of Personalisation of Service Discovery Electronics and Computer Science, University of Southampton myGrid UK e-Science Project Juri Papay,

IBM Watson Research © 2004 IBM Corporation BioHaystack: Gateway to the Biological Semantic Web Dennis Quan

Simon Woodman Hugo Hiden Paul Watson Jacek Cala. Outline 1. What is e-Science Central? 2. Architecture and Features 3. Workflows and Applications.

GOAT: The Gene Ontology Annotation Tool Dr. Mike Bada Department of Computer Science University of Manchester

GADA Workshop 1-2 November 2005 Life Science Grid Middleware in a More Dynamic Environment Milena Radenkovic & Bartosz Wietrzyk The University of Nottingham,

On the Use of Agents in a BioInformatics Grid with slides from Luc Moreau, University of Southampton,UK myGrid.

EGC2005 European Grid Conference,Amsterdam, Feb 2005 (Semantic Grid) Services + Semantic (Grid Services) Professor Carole Goble The University of.

An integrative approach for attaching semantic annotations to service descriptions Luc Moreau, University of Southampton,UK.

GGF Summer School 24 th July 2004, Italy Part 3: Integrating Services Life Science Identifiers & Information model. Data and Metadata management – the.

The my Grid project aims to provide middleware layers that make the Information Grid appropriate for the needs of bioinformatics. my Grid is building high.

Personal Data Management Why is this such an issue? Data Provenance Representing links v Representing data Identifying resources: Life Science Identifiers.

1 Middleware for In silico Biology Phillip Lord

14-18 March 2004 EDBT'04 : Service-Based Distributed Query Processing for the Grid (M N Alpdemir) 1 Title, places, people, funding, projects Manchester.

Metadata in my Grid: Finding Services for in silico Science Dr Katy Wolstencroft myGrid University of Manchester.

Provenance in my Grid Jun Zhao School of Computer Science The University of Manchester, U.K. 21 October, 2004.

Deciding Semantic Matching of Stateless Services Duncan Hull †, Evgeny Zolin †, Andrey Bovykin ‡, Ian Horrocks †, Ulrike Sattler † and Robert Stevens †

Database Taskforce and the OGSA-DAI Project Norman Paton University of Manchester.

CHESS seminar July 2005 Promoting reuse and repurposing on the Semantic Grid Antoon Goderis University of Manchester, UK CHESS seminar, 19 July 2005.

Taverna and my Grid Basic overview and Introduction Tom Oinn

Integrating Business Process Models with Ontologies Peter De Baer, Pieter De Leenheer, Gang Zhao, Robert Meersman {Peter.De.Baer, Pieter.De.Leenheer,

The GRIMOIRES Service Registry Weijian Fang and Luc Moreau School of Electronics and Computer Science University of Southampton.

An Introduction to Taverna Workflows Franck Tanoh my Grid University of Manchester.

1 A myGrid Project Tutorial Dr Mark Greenwood University of Manchester With considerable help from Justin Ferris, Peter Li, Phil Lord, Chris Wroe, Carole.

Taverna and my Grid Open Workflow for Life Sciences Tom Oinn

1 The myGrid Project Professor Chris Greenhalgh University of Nottingham.

Taverna: A Workbench for the Design and Execution of Scientific Workflows Dr Katy Wolstencroft myGrid University of Manchester.

MyGrid: Personalised e-Biology on the Grid Professor Carole Goble Contact e-Science.

MyGrid: Personalised e-Biology on the Grid Professor Carole Goble Contact

My Grid: Upper level Grid Services for the Bioinformatican Prof. Carole Goble Sun Microsystems BioGrid Symposium, Baltimore, USA.

1 A National Virtual Specimen Database for Early Cancer Detection June 26, 2003 Daniel Crichton NASA Jet Propulsion Laboratory Sean Kelly NASA Jet Propulsion.

E-Science Tools For The Genomic Scale Characterisation Of Bacterial Secreted Proteins Tracy Craddock, Phillip Lord, Colin Harwood and Anil Wipat Newcastle.

Joint agINFRA & SCI-BUS workshop, 30/05/2013, Budapest, Hungary FP 7-INFRASTRUCTURES programme agINFRA Joint agINFRA & SCI-BUS workshop agINFRA.

Integrating BioMedical Text Mining Services into a Distributed Workflow Environment Rob Gaizauskas, Neil Davis, George Demetriou, Yikun Guo, Ian Roberts.

MyGrid and the Semantic Web Phillip Lord School of Computer Science University of Manchester.

Taverna Workflows for Systems Biology Katy Wolstencroft School of Computer Science University of Manchester.

VBI Web Services Workshop May 2005 Performing In silico Experiments in a Service Based Architecture: Solutions and Issues Chris Wroe, Phillip Lord,

Professor Carole Goble

©Ferenc Vajda 1 Semantic Grid Ferenc Vajda Computer and Automation Research Institute Hungarian Academy of Sciences.

Anil Wipat University of Newcastle upon Tyne, UK A Grid based System for Microbial Genome Comparison and analysis.

Capture, integration, and sharing of functional genomic data Steve Oliver Professor of Genomics School of Biological Sciences University of Manchester.

Quality views: capturing and exploiting the user perspective on data quality Paolo Missier, Suzanne Embury, Mark Greenwood School of Computer Science University.

Semantic Mediation in myGrid Chris Wroe Manchester University.

Workflow in Grid Systems Workshop Dave Berry, Research Manager UK National e-Science Centre GGF10, Mar 2004.

LSIDs in a Nutshell Jun Zhao University of Manchester 1 st December, 2005.

MyGrid: open knowledge based high level services for bioinformatics the information Grid Professor Carole Goble University of Manchester, UK

Association of variations in I kappa B-epsilon with Graves' disease using classical and my Grid methodologies Peter Li School of Computing Science University.

GGF Summer School 24th July 2004, Italy Part 2: Architecture overview Professor Carole Goble University of Manchester

GGF11 Semantic Grid Applications Workshop, Hilton Hawaiian Village Beach Resort & Spa, Honolulu, Thursday June 10, 2004 Exploring Williams-Beuren Syndrome.

Bioinformatics Workflows Chris Wroe (based on material from the myGrid team & May Tassabehji / Hannah Tipney Medical Genetics, St Marys)

Presented by Jens Schwidder Tara D. Gibson James D. Myers Computing & Computational Sciences Directorate Oak Ridge National Laboratory Scientific Annotation.

A Practical Approach to Metadata Management Mark Jessop Prof. Jim Austin University of York.

PharmaGrid 2004, Switzerland, July Part 5: Wrap Up Professor Carole Goble University of Manchester

EMBL-EBI Structural Proteomics Automatic Target Selection Gordon Whamond.

Using DAML+OIL Ontologies for Service Discovery in myGrid Chris Wroe, Robert Stevens, Carole Goble, Angus Roberts, Mark Greenwood

Portals and my Grid Stefan Rennick Egglestone Mixed Reality Laboratory University of Nottingham.

1 A myGrid Project Tutorial (3) Dr Mark Greenwood University of Manchester With considerable help from Justin Ferris, Peter Li, Phil Lord, Chris Wroe and.

Life Science Identifiers Chris Wroe (based on material from myGrid team and IBM Life Sciences)

OGSA-DQP Steven Lynden University of Manchester. Data access & integration with OGSA-DAI: GGF 17 2 Introduction OGSA-DQP is a service based distributed.

MyGrid: Personalised Bioinformatics on the Information Grid Robert Stevens, Alan Robinson & Carole Goble University of Manchester & EBI, UK myGrid project.

Workflow and myGrid Justin Ferris IT Innovation Centre 7 October 2003 Life Sciences Grid GGF9.

Taverna: A Workbench for the Design and Execution of Scientific Workflows Paul Fisher University of Manchester.

Provenance: Problem, Architectural issues, Towards Trust

LSIDs in Taverna Daniele Turi University of Manchester

A myGrid Project Tutorial

Presentation transcript:

The my Grid Information Model Nick Sharman, Nedim Alpdemir, Justin Ferris, Mark Greenwood, Peter Li, Chris Wroe AHM2004, 1 September

The my Grid Information Model Outline my Grid in context Science & e-Science The information model Next steps Conclusions

Third-party tools Utopia Haystack (IBM) LSID Launchpad (IBM) my Grid information model The my Grid Information Model my Grid in Context External Services Applications Web portals Taverna e-Science workbench Legacy apps Web Services OGSA-DAI databases Websites Core Services Service & workflow discovery Feta semantic discovery View federated UDDI+ Workflow enactment Freefluo workflow engine Metadata Management RDF-based Metadata store Provenance capture tool my Grid ontology Notification service LSID support Data Management my Grid information repository AMBIT text extraction service Soaplab Gowlab OGSA-DAI DQP service Web Service (Grid Service) communication fabric

The my Grid Information Model Science and e-Science The scientific process: 1.Observe and describe phenomena and study existing knowledge 2.Formulate a hypothesis to explain the phenomena 3.From the hypothesis, predict other phenomena 4.Develop and perform repeatable experiments that test the predictions. E-science parallels: 1.Search online repositories, with workflows and queries 2.Create domain ontologies to express hypotheses and … 3.… predictions 4.Workflows and queries can be preserved, shared, re-enacted

The my Grid Information Model Aspects of the model Based on the CCLRC Scientific Metadata Model (Matthews & Sufi) Programmes, studies & experiments People & organizations Data types Provenance metadata Annotation & argumentation

The my Grid Information Model Programmes, studies & experiments

The my Grid Information Model Provenance metadata

AC Homo sapiens BAC clone CTA-315H11 from 7, complete sequence AC Homo sapiens BAC clone RP11-622P13 from 7, complete sequence AL Human DNA sequence from clone RP11-553N16 on chromosome 1, complete sequence AL Homo sapiens chromosome 21 segment HS21C AL Human chromosome 14 DNA sequence BAC R-775G15 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence BX Homo sapiens mRNA; cDNA DKFZp686G08119 (from clone DKFZp686G08119) AC Homo sapiens 12q22 BAC RPCI11-256L6 (Roswell Park Cancer Institute Human BAC Library) complete sequence AK Homo sapiens cDNA FLJ45040 fis, clone BRAWH AC Homo sapiens chromosome 17, clone RP11-104J23, complete sequence AL Human DNA sequence from clone RP4-715N11 on chromosome 20q Contains two putative novel genes, ESTs, STSs and GSSs, complete sequence AC Homo sapiens BAC clone RP11-731I19 from 2, complete sequence AC Homo sapiens chromosome 15, clone RP11-342M21, complete sequence AL Human DNA sequence from clone RP11-461K13 on chromosome 10, complete sequence AC Homo sapiens PAC clone RP3-368G6 from X, complete sequence AC Homo sapiens chromosome 4 clone B200N5 map 4q25, complete sequence AF Homo sapiens chromosome 21q22.3 PAC 171F15, complete sequence >gi| |gb|AC | Homo sapiens BAC clone CTA-315H11 from 7, complete sequence AAGCTTTTCTGGCACTGTTTCCTTCTT CCTGATAACCAGAGAAGGAAAAGATC TCCATTTTACAGATGAG GAAACAGGCTCAGAGAGGTCAAGGCT CTGGCTCAAGGTCACACAGCCTGGGA ACGGCAAAGCTGATATTC AAACCCAAGCATCTTGGCTCCAAAGC CCTGGTTTCTGTTCCCACTACTGTCAG TGACCTTGGCAAGCCCT GTCCTCCTCCGGGCTTCACTCTGCAC ACCTGTAACCTGGGGTTAAATGGGCT CACCTGGACTGTTGAGCG urn:lsid:taverna:datathing:15..BLAST_Report rdf:type urn:lsid:taverna:datathing:13..similar_sequences_to.. nucleotide_sequence rdf:type service invocation..created_by workflow invocation workflow definition experiment definition project person group service description organisation..described_by..run_during..invocation_of..part_of..works_for..part_of..author..run_for..masked_sequence_of..filtered_version_of The my Grid Information Model Annotation & argumentation

The my Grid Information Model Next Steps: modelling e-science events Third-party tools Utopia Haystack (IBM) LSID Launchpad (IBM) my Grid information model Applications Core Services External Services Service & workflow discovery Feta semantic discovery View federated UDDI+ Web portals Taverna e-Science workbench Workflow enactment Freefluo workflow engine Metadata Management RDF-based Metadata store Provenance capture tool my Grid ontology Soaplab Gowlab AMBIT text extraction service Legacy apps Web Services OGSA-DAI databases Websites OGSA-DAI DQP service e-Science coordination e-Science Mediator e-Science process patterns e-Science events LSID support Data Management my Grid information repository Web Service (Grid Service) communication fabric Notification service

The my Grid Information Model Conclusions Builds on existing work –CCLRC Scientific Metadata Model –LSID: gives access via third party tools –Semantic web Persistent types almost implemented Transient types in progress Needs validating –Early versions already doing useful work

The my Grid Information Model The my Grid team Matthew Addis, Nedim Alpdemir, Pinar Alper, Rich Cawley, Neil Davis, Vijay Dialani, Stefan Egglestone, Alvaro Fernandes, Justin Ferris, Rob Gaizauskas, Kevin Glover, Carole Goble (director), Chris Greenhalgh, Mark Greenwood, Yikun Guo, Ananth Krishna, Peter Li, Xiaojian Liu, Phil Lord, Darren Marvin, Karon Mee, Simon Miles, Luc Moreau, Arijit Mukherjee, Tom Oinn, Juri Papay, Norman Paton, Terry Payne, Steve Pettifer, Milena Radenkovic, Peter Rice, Angus Roberts, Alan Robinson, Martin Senger, Nick Sharman, Robert Stevens, Victor Tan, Paul Watson, Anil Wipat, Chris Wroe & Jun Zhao.