Harvard iGEM 2006 Cyanobacterial Oscillator From cyanobacteria......to E. coli Photosynthetic Circadian rhythm Evolved over billions of years Model organism.

Slides:



Advertisements
Similar presentations
Repressilator: “I’ll be back.”
Advertisements

Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust biological oscillating biobrick.
Week 8. Outline Project Goal Extracting and biobricking KaiA and KaiB Synthesis update Western Blotting update Site-Specific Mutagenesis update Promoter.
Combinatorial Synthesis of Genetic Networks Guet et. al. Andrew Goodrich Charles Feng.
MCB 186 CIRCADIAN BIOLOGY The cellular-molecular mechanism of the circadian clock CLOCK MUTANTS Lecture #4 October 18, 2006 J. W. Hastings.
Cyanobacterial Oscillator in E. coli Why care about biological oscillators in the first place? Bio-oscillators have a number of potential applications:
Mukund Thattai NCBS Bangalore genetic networks in theory and practice.
A Synthetic Biology Approach to Discerning Circadian Output Pathways in Cyanobacteria Zhipeng Sun MCB186 Final Project December 13, 2006.
CYANOBACTERIA CLOCK MCB 186 CIRCADIAN BIOLOGY December 13, 2006 Hetmann Hsieh Proposal to Determine the Posttranslational Effect of Circadian Clock–Resetting.
MCB 186 CIRCADIAN BIOLOGY Slides Lecture 3 Clock genes & Biochemical Mechanisms October 5, 2005 J. W. Hastings.
What Is the Mechanism of the Cyanobacterial Circadian Oscillator? Mike Rust O’Shea Group 10/10/2007 MCB 186 CIRCADIAN BIOLOGY.
Oscillatory Systems Jesse Wu Outline What is an oscillator? Types of oscillators Oscillator related things to think about.
Harvard iGEM 2006 Cyanobacterial Oscillator From cyanobacteria......to E. coli Photosynthetic Circadian rhythm Evolved over billions of years Model organism.
Designing, Building, and Using DNA Nanoboxes: - Inside-Outside Specific Protection of Sites - Tiffany Chan - Harvard International Genetically Engineered.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
MCB 186 CIRCADIAN BIOLOGY Clock genes & Biochemical Mechanisms: Kai genes October 10, 2007 J. W. Hastings.
Information in Biology. Outline What is synthetic biology? Biological Clocks The “Repressilator” Signal transduction The “Diverter”
Week 4: Eureka!. Phone conversation with Professor Susan Golden at Texas A&M: Professor Golden is one of the leading experts in cyanobacteria and has.
The robust ticking of a circadian clock David Zwicker, Jeroen van Zon,David Lubensky, Pim Altena, Pieter Rein ten Wolde Beijing, July 27, 2010 Synechococcus.
Taattcgcggccgcttctagagattgtgagcggataacaattgacattgtgagcggataacaagatactgagcactactagagaaagaggagaaatactagatgactataatgataaaaaaat cggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactc.
Construction of a genetic toggle switch in Escherichia coli Farah and Tom.
Harvard iGEM 2007 Introduction Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Harvard iGEM 2005: Team BioWire and BioLoserz!!! LOL Orr Ashenberg, Patrick Bradley, Connie Cheng, Kang-Xing Jin, Danny Popper, Sasha Rush.
Circadian rhythm March tongli zhang. Circadian rhythm.
Protein delivery: DNA nanostructures and cell-surface targeting Harvard iGEM August 27, 2006.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Week 5. 1.Create KaiA and KaiBC biobricks. 2.Transform E. coli with Kai Biobricks to reconstitute KaiC phosphorylation cycle with no reporter attached.
Week 9 review Cyanobacteria Oscillator in E. coli.
PowerPoint Slides for Chapter 16: Emergent Properties at the Molecular Level by A. Malcolm Campbell, Laurie J. Heyer, and Chris Paradise Title Page Integrating.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
The little oscillator that could. and could…
Week 7 review Cyanobacteria Oscillator in E. coli.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Week 6. Outline Background Information Update: new paper out July 21 st Experimental Progress Current challenges Bad template Successful colony PCR (try.
Cling-E. coli : Bacteria on target Harvard iGEM 2007 Ellenor Brown Stephanie Lo Alex Pickett Sammy Sambu Kevin Shee Perry Tsai Shaunak Vankudre George.
Hetmann Hsieh Jeffrey Lau David Ramos Zhipeng Sun.
Designing DNA Nanostructures to encapsulate and release proteins iGEM August 21, 2006 Katherine Fifer with Valerie Lau, Matthew Meisel, and Tiffany Chan.
The little oscillator that could. and could…
Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust oscillator BioBrick.
Harvard iGEM 2006 Cyanobacterial Oscillator Hetmann Hsieh Jeff Lau Dave Ramos Zhipeng Sun Harvard iGEM 2006 Creating a robust biological oscillating biobrick.
Cling-E. coli : Bacteria on target
Harvard iGEM 2006 Week 3 Peng, David, Jeff, Hetmann
Harvard iGEM 2006.
DHEA(S) and Allo induced the phosphorylation of PKC in serum-deprived PC12 cells. DHEA(S) and Allo induced the phosphorylation of PKC in serum-deprived.
Cling-E. coli : Bacteria on target
Cyanobacteria Oscillator
A Cyanobacterial Circadian Clockwork
Cyanobacterial Oscillator
Virginia iGEM Workshop #2 High School Education Series.
Andrian Gutu, Erin K. O’Shea  Molecular Cell 
Cling-E. coli : Bacteria on target
Cyanobacterial Oscillator
Cling-E. coli : Bacteria on target
Cling-E. coli : Bacteria on target
Cling-E. coli : Bacteria on target
Cling-E. coli : Bacteria on target
Week 4: Eureka!.
Cyanobacterial Oscillator
Protein delivery: DNA nanostructures and cell-surface targeting
Cyanobacterial Oscillator
Cyanobacterial Oscillator
Cyanobacterial Oscillator
Cyanobacterial Oscillator
TIPI mediates rapid degradation of proteins in yeast.
Cyanobacteria Oscillator
Welcome to iGEM 2007!.
Vps36 interacts with Smo in the absence of Hh
Transplantability of a circadian clock to a noncircadian organism
Presentation transcript:

Harvard iGEM 2006 Cyanobacterial Oscillator From cyanobacteria......to E. coli Photosynthetic Circadian rhythm Evolved over billions of years Model organism for synthetic biology BioBrick registry

Harvard iGEM 2006 Cyanobacterial Oscillator Time Applications of a Bio-oscillator Clock Nightlight Timed drug delivery Pharmaceutical processes Bio-circuitry Investigate natural systems 12PM 6PM6AM6PM 12AM output pathways.jpg

Harvard iGEM 2006 Cyanobacterial Oscillator The Repressilator Cyanobacteria Bio-oscillator Lac λ - cI Tet Elowitz et al ` Time Fluorescence 10h24h

Harvard iGEM 2006 Cyanobacterial Oscillator PP P P P P The Kai Clock in Cyanobacteria KaiC autophosphorylates and dephosphorylates KaiA promotes phosphorylation KaiB inhibits KaiA Transcription-translation independent Period: h Time Phosphorylation of KaiC b

Harvard iGEM 2006 Cyanobacterial Oscillator Achievements Goal: reconstitute the cyanobacteria Kai oscillator in E. coli 1.Created KaiA, KaiB, and KaiC BioBricks. 2.Combined the above with registry parts to form functional BioBricks. 3.Expressed Kai proteins in E. coli and verified interaction.

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Constructs Created We’ve made the following constructs: Kai genes Lac promoter + Kai genes KaiA + KaiC and KaiB + KaiC (with promoters)

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Proteins Interact in E. coli Constructs transformed in E. coli Cultures sampled at OD 0.55 Western blot washed with anti-KaiC antibodies Western blot image

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Proteins Interact in E. coli Western blot image P P P P P P P PP

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Proteins Interact in E. coli Western blot image P P P P P P P PP

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Proteins Interact in E. coli Western blot image P P P P P P P PP

Harvard iGEM 2006 Cyanobacterial Oscillator Results: Proteins Interact in E. coli Western blot image Conclusion: KaiA and KaiC are expressed and interacting KaiB not verified, but results consistent with predictions

Harvard iGEM 2006 Cyanobacterial Oscillator PP P P P P Further challenges Verify oscillation in E. coli. Synchronization problem Between cells Within cell Time Solution: pulsed expression

Harvard iGEM 2006 Thanks for listening Conclusion be sure not to say not the only oscillating bacteria “do not say more scienfitic” – say investiage natural systems More stuff on the scientific/pharmacutical Say “We interpret these bands as showing...” not that “they are phosphorylated bands” Future work: sentence about what the experiment is (syncronize cultures by pulsing inducible promoters) say stable over time mention that we added parts to the registry

Harvard iGEM 2006 Word up Acknowledgements Our teaching fellows: Chris Doucette, Shawn Douglas, and Nick Stroustrup Our advisors: Profs. Alain Viel, George Church, Pam Silver, William Shih, Radhika Nagpal, and Jagesh Shah Prof. Susan Golden at Texas A&M for advice and antibodies Peter MIT and Eric WHOI for cyanobacteria Mark MIT and Filiz BU for streptavidin clones