SGPPname Crystals seen?ListEnzyme name PfAl007201WESYesWesthioredoxin PfAl006677WES WesCholine kinase PfAl008572WES Wescyclophilin-like PfAl004964WES WesProtein.

Slides:

Advertisements

Similar presentations

1 Chapter 43 Inborn Metabolic Defects of Lysosomes, Peroxisomes, Carbohydrates, Fatty Acids and Mitochondria Copyright © 2012, American Society for Neurochemistry.

Advertisements

Manipulating molecules Biot-111 Lecture 4. Types of molecules Nucleic Acids –Deoxyribonucleic acid (DNA) Chromosomal DNA Mitochondrial DNA (mtDNA, or.

DNA Replication. Each cell within a body contains the same DNA sequence. Why? Before the cell divides, an exact copy of DNA is made- process called REPLICATION.

Principles of Biochemistry

Signal Transmission & Gene Expression AKA – Cell Signaling Basics (we will revisit this topic during body systems)

Signaling and the Signal Transduction Cascade. Question?????? External Stimulus Inside cell Nucleus, Gene transcription Other cellular effects.

Chapter 3 (part 2) – Protein Function. Test Your Knowledge (True/False) All proteins bind to other molecules. Explain. What sort chemical interactions.

Unless otherwise noted, the content of this course material is licensed under a Creative Commons Attribution – Share Alike 3.0 License. Copyright 2007,

ENZYME CLASSIFICATION EXERCISE (1) GLUCOSE + ATP  GLUCOSE-6-PHOSPHATE + ADP + H + (2) CH 3 CH 2 OH + NAD +  (CH3)CHO + NADH + H + (3) ATP + H 2 O  ADP.

Structural Genomics of Pathogenic Protozoa Christopher Mehlin Protein Production and Crystallization Workshop 2004

PRPP synthetase Nucleoside phosphorylases Phosphoribosyl transferases.

DENTAL BIOCHEMISTRY 2015 Lecture 11 PENTOSE PHOSPHATE PATHWAY AND GLYCOGEN METABOLISM Michael Lea.

Chapter 17 (part 2) Protein Turnover and Amino Acid Catabolism.

PKG Signalling PDK1PKG T58 T516 ? PKC  cGMP. S1105 S23 PLCB3 T1122 PDE5A S106 GUCY1A3 S64 eNOS S1177 PDK1PKG T58 T516 ? PKC  cGMP PKG Signalling.

ENZYMES Crystal structure of trypsin

1 Chapter 3: Protein ZHOU Yong Department of Biology Xinjiang Medical University.

Anusorn Cherdthong, PhD Applied Biochemistry in Nutritional Science E-learning:

Glycogen Metabolism Reducing end.

E N Z Y M E SE N Z Y M E S. Enzyme : – mostly proteins, but some catalytic RNA molecules (ribosymes) – extraordinary catalytic power – high degree of.

Zeatin Cis-Trans Isomerase in Plants Tomáš HLUSKA Department of Molecular Biology Centre of the Region Haná for Biotechnological and Agricultural Research.

Copyright © 2006 by Elsevier, Inc. Adenosine triphosphate (ATP) - the central link between energy-producing and energy-using systems of the body Figure.

Enzymes grouped in 6 major classes: (p. 643) 1. Oxidoreductases: Double-barreled name catalyze the reduction or oxidation of a molecule. 2. Transferases:

Prof. A.S. Kolaskar Vice Chancellor University of Pune Bioinformatics for Parasitic diseases: Malaria.

(1) End labelling The enzyme polynucleotide kinase is used to transfer the terminal phosphate group of a radiolabelled ATP into 5- hydroxyl termini of.

Glycolysis. Summary of glycolysis. The pathway of glycolysis.

CGMP-dependent Protein Kinase Signalling Pathways Produced by Dr. Steven Pelech Kinexus Bioinformatics Corporation Copyright 2010.

Glycogen Metabolism Glycogen Metabolism.

Sugar nucleotides and glycogen metabolism

CAMP Controls Activity of Protein Kinase A R C R C R R A A A A A A A A C C Regulatory subunits Catalytic subunits cAMP Active kinase C CREB P Nucleus Activation.

MiRNAPredicted targetsPutative function of targets miRC1GRMZM2G029833_T01DNA binding / DNA-directed RNA polymerase miRC4 GRMZM2G171796_T01; GRMZM2G355906_T03;

Table S4. Summary of proteins identified by MALDI-TOF-MS Spot no.* Average Ratio** NCBI accesion no. Gene nameProtein name Theoretical pI/MW SCORE Sequence.

Complete list of LC-MS myc interating protiens in the MCF7 cells, proteins highlighted in red are those differentially expressed from the LCC1 and LCC1.

Work package 2 (WP2) Topic: Cyanobacterial Dormant Forms in an Aquatic environment Objective: To reveal conditions and processes involved in germination.

GO-Slim term Cluster frequency cytoplasm 1944 out of 2727 genes, 71.3% 70 out of 97 genes, 72.2% out of 72 genes, 86.1% out.

KREBS CYCLE (Tricarboxylic Acid Cycle) (Citric Acid Cycle)

10-2 Glycogen (starch) metabolism Figures: Stryer-5ed; chapter: 21 Lehninger-4ed; chapters: 7, 15, 23.

How Enzymes Work Pratt & Cornely Ch 6.

CCAGTTGCCGCGTTCACCCTCTCCTCATCCGCGGTTCACCGGCCTCGTTGAGACTGCCTG  SCO0033 GGCCGTCATTCCGACAGCACCCACGTCTCACTCCCCGTGCCCATGCGGGGACCGGGCGGC CCGGCAGTAAGGCTGTCGTGGGTGCAGAGTGAGGGGCACGGGTACGCCCCTGGCCCGCCG.

Enzymes: Basic concepts

New targets since 7/22/05: Tbru015978AAADihydroorotate dehydrogenase Chunks since 6/17/05: Lmaj002537BAIProtein tyrosine phosphatase Lmaj002537BAFProtein.

Protein. Protein and Roles 1: biological process unknown 1.1 Structural categories 1.2 organism categories 1.3 cellular component o unlocalized.

20.4 Regulation of Enzyme Activity

S2 Supporting information: RT-qPCR experiment

The adrenal cortex consists of three histologically distinct zones: the outer zona glomerulosa, the middle zona fasciculata, and an innermost layer called.

Actn3 KO mice display a shift toward more oxidative pathways of metabolism Enzyme analyses show increased expression of enzymes involved in the glycolysis.

Acetyl-CoA and the Citric Acid Cycle

Nucleoside 2p Nucleoside 5'-diphosphate kinase is a cytosolic enzyme. Nucleoside 5'-diphosphate kinase from Saccharomyces cerevisiae is found highly expressed.

Glycogen Metabolism Title slide - metabolism of glycogen.

Enzymes Enzymes can speed up a chemical reaction without being altered. Enzymes are biological catalysts. Each acts on a specific substance. The specificity.

Pyruvate Oxidation and the Citric Acid Cycle

Inositol as putative integrative treatment for PCOS

Amino acid synthesis Title slide - amino acid synthesis.

Chapter 20 Enzymes and Vitamins

The Electron Transport Chain

Questions Starvation.

1) To describe how the structure of DNA allows it to copy itself

Glycogen Storage Diseases

Cell to Cell Communication

4 th SEMESTER – BOTANY KARNATAKA UNIVERSITY, DHARWAD Modified from various internet resources by Dr. Jayakara Bhandary Associate Professor of Botany Government.

Condensed metabolic map of M

Pyruvate Dehydrogenase

Glycogen Metabolism Reducing end.

ATP binding sites – Shared Ancestry versus Convergent Evolution

Amino Acids, Proteins, and Enzymes

Classification of Enzymes

Philip Cohen, Marianna Tcherpakov Cell

Chapter 17 Choline and Brain Development

The pathways of central metabolism.

Phosphorylation Addition of a phosphate (PO4) group to a protein or other organic molecule. Phosphorylation activates or deactivates many protein enzymes,

Presentation transcript:

SGPPname Crystals seen?ListEnzyme name PfAl007201WESYesWesthioredoxin PfAl006677WES WesCholine kinase PfAl008572WES Wescyclophilin-like PfAl004964WES WesProtein phosphatase 2C (30% similar) PfAl005921WES WesGlyoxalase I PfAl005676WESYes?WesAdensosine deaminase PfAl008421WESYesWesPurine nucleoside phosphorylase Lmaj003024AAA WesEuk. Init. Factor 5A Linf002302AAA Wesuracil DNA glyoxylase Linf007771AAA Wescyclophilin Linf008585AAA Wescitrate lyase beta chain Lbra002030AAA WesDihydroorotate dehydrogenase Lguy003024AAA WesEuk. Init. Factor 5A 13/88 (15%) Progress in expression of Pf enzymes

SGPPname Crystals seen?ListEnzyme name Pfal004546AAAYESFred6-pyruvoyl tetrahydropterin synthase Pfal006386AAAYesFredserine/threonine kinase Pfal006597AAAYesFredubiquitin conjugating enzyme Pfal006436AAA Freddihydrofolate synthase/folylpolyglutamate synthase Pfal006583AAA Fredadenylosuccinate synthetase Pfal008494AAA Fredphosphomethylpyrimidine kinase Pfal009132AAAYESFredglycerol-3-phosphate dehydrogenase Pfal008434AAA Fredribose 5-phosphate epimerase Pfal008495AAA FredBIS(5'-nucleosyl)-tetraphosphatase (diadenosine tetraphosphatase), Pfal004811AAA Fredserine/threonine protein kinase 2 Pfal005612AAA Fredorotidine-monophosphate-decarboxylase Pfal007858AAA Fredubiquitin-conjugating enzyme E2 Pfal008828AAA Freds-adenosylmethionine synthetase Pfal008498AAA Fredadenosylhomocysteinase(S-adenosyl-L-homocysteine hydrolase) Pfal005333AAA Fredubiquitin-conjugating enzyme, putative Pfal006626AAA FredATP-dependent DNA helicase, putative Pfal008831AAA FredPhosphoglycerate kinase Pfal007922AAA Fredglycogen synthase kinase, putative Pfal006645AAAyesFrednucleoside diphosphate kinase b; putative Pfal007254AAA Fredglyceraldehyde-3-phosphate dehydrogenase Pfal006371AAA Fredbranched-chain alpha keto-acid dehydrogenase, putative 21/95 (22%) Progress in expression of Pf enzymes (cont.)

Enzymes in Trypanosomatids Wes list: –L. major –L. infantum –T. cruzi Fred list: