Supporting information Figs S1-S5. Figure s1 Histochemical assay of root H 2 O 2 All of roots from seedlings grown in MS or containing 20 µM ABA for 12.

Slides:



Advertisements
Similar presentations
Ectopic lignification in the flax lignified bast fiber mutant
Advertisements

A Hypothesis for the function of gene AT4G23180 in A. thaliana By Nicole Foxworth and Deborah Lee (Ether Fowl Ox)
Enzyme activity (μmol mg protein-1 min -1 ) DAA Xu-142 Xu-142 fl mutant CIN VIN CWIN (C) Supplemental Figure 1 Control.
A B C * * * * * Stomatal aperture (width/length) flg22 chitin D * * Relative HopM1 expression E Total photon count H2O2H2O2.
Figure S1. The coding sequence alignment among OsAHPs and OsPHPs, and the relative expression of OsAHPs and OsPHPs in OsAHPs-RNAi and wild-type rice seedlings.
Supplemental Figure 1. The wxr3 mutant exhibits decreased expression of CYCB1;1, SCR and SHR compared with the control. A and B, Expression of ProCYCB1;1:GUS.
Lim et al, Supplemental Figure S1. OsRING-H2 type : 5 OsRING-HC type : 1 OsRING-v type : 1 OsRING-H2 type : 9 OsRING-HC type : 8 OsRING-v type : 2 OsRING-H2.
Fig. S1 Illustration of the fine-mapping evolution of cmr1 Arabidopsis mutant. F 2 mutant individuals were used for mapping. Molecular markers used in.
Control 50 ng/  l 250 ng/  l 500 ng/  l (A) IAA in 3-mm tip(B) IAA diffused into agar Time after labeled Trp application (min) Labeled IAA (%) IAA (pg.
Figure S1. Alignment of identified AtMYB93/92/53 homologues in land plants, used to infer the phylogeny in Figure 1B. Supporting information Figs S1-S7.
Genetic evidence for essential calcium transporters in pollen growth and fertilization. Sabine Frietsch 1,3, Shawn M. Romanowsky 1,2, Morton Schiøtt 4,
OST1 is Limiting in ABA Responses of Arabidopsis Guard Cells Biswa R. Acharya 1, Byeong Wook Jeon 1, Wei Zhang 1, 2* and Sarah M. Assmann 1, * *Corresponding.
Figure S1 Enod11 Mtc27 MtGshs cDNA gDNA S. meliloti DPI Supporting Information Fig. S1. Validation of the selected biological conditions for.
Gene expression (signal intensity) Control Osmotic Salt Drought Root Control Gene expression (signal intensity) Treatment.
Figure S1. Figure S1. Relative expression levels of YUC family member transcripts in roots under high and low N conditions. Seedlings 4 days after germination.
(a) (b) Col-NI Col-I nrt2.5x2.6 NI Col-NICol-I nrt2.5x2.6 NI nrt2.5x2.6 I Fig. S1 DAB staining of Arabidopsis thaliana Col-0 wild-type or nrt2.5xnrt2.6.
Fig. S1. Amino acid sequence alignment of MYBS3 proteins. MYBS3 protein sequences of Arabidopsis thaliana (MYBH; NP_199550); (At3g16350; NP_188256), Glycine.
Fig. S1 Quantitative and semi-quantitative RT-PCR analyses confirms the down regulation of SGT1, SKP1, RAR1, RBX1 and CUL1c gene transcripts.
Supplementary Fig. S1: GO classification of 2,318 differentially expressed genes during fruit ripening in tomato. The genes which show differential expression.
WT#3#5#7#9#11#14#15#20#25#30 35S::JAZ13 Root length ratio * * * * * * * * * * Figure S2. Overexpression of native (untagged)
Figure S1 (Chen) (a) 1xABRC321:GUS 1xABRC321 2xABRC321:GUS 2xABRC321 3xABRC321:GUS 3xABRC321 GUS 0xABRC321:GUS Amy64 mini PHVA22 In1-Ex2-In2 HVA22 3’ -60.
ATG AREB1 (At1g45249) AREB2 (At3g19290) ABF3 (At4g34000) ABF1 (At1g49720) No treatmentABA, 6h Chr. 1 areb1 (SALK_002984) // Chr. 3 Chr. 4 abf1-2 (SALK_132819)
Normal skin tissue Supplementary Fig 1A KLF4 has a tumor suppressive function in human skin cancer. Skin cancer tissues were deparaffinized and IHC was.
Figure S1 (a) (b) Fig. S1. Hydroponics culture of Arabidopsis thaliana. (a) Illustration of the hydroponics system in the growth chamber. (b) close-up.
Characterization of gig1 (glucose insensitive growth 1) Reveals the Involvement of the Plastidic Copper Transporter PAA1 in Sugar-mediated Interorganellar.
Potassium Transporter KUP7 Is Involved in K+ Acquisition and Translocation in Arabidopsis Root under K+-Limited Conditions  Min Han, Wei Wu, Wei-Hua Wu,
BRC Science Highlight WRINKLED1, a key regulator of oil biosynthesis, also affects hormone homeostasis Objective WRINKLED1 (WRI1) is a key transcriptional.
The Alfin-like PHD Zinc Finger Transcription Factor Family
Ulrich auf dem Keller, Angelika Kümin, Susanne Braun, Sabine Werner 
Volume 6, Issue 2, Pages (March 2013)
Volume 25, Issue 19, Pages (October 2015)
Arabidopsis Transcription Factor Genes NF-YA1, 5, 6, and 9 Play Redundant Roles in Male Gametogenesis, Embryogenesis, and Seed Development  Jinye Mu,
Volume 2, Issue 1, Pages (January 2009)
Volume 7, Issue 5, Pages (May 2014)
Phenotypic analysis of brl mutants and genetic combinations of double and triple mutants with bri1. Phenotypic analysis of brl mutants and genetic combinations.
Volume 10, Issue 11, Pages (November 2017)
Potassium Transporter KUP7 Is Involved in K+ Acquisition and Translocation in Arabidopsis Root under K+-Limited Conditions  Min Han, Wei Wu, Wei-Hua Wu,
Volume 3, Issue 2, Pages (August 2002)
Volume 9, Issue 4, Pages (April 2016)
Volume 7, Issue 9, Pages (September 2014)
Volume 2, Issue 1, Pages (January 2009)
Liyuan Chen, Anne Bernhardt, JooHyun Lee, Hanjo Hellmann 
Volume 8, Issue 5, Pages (May 2015)
Arabidopsis ROP1 and ROP6 Influence Germination Time, Root Morphology, the Formation of F-Actin Bundles, and Symbiotic Fungal Interactions  Yvonne Venus,
Volume 4, Issue 3, Pages (May 2011)
The WUSCHEL Related Homeobox Protein WOX7 Regulates the Sugar Response of Lateral Root Development in Arabidopsis thaliana  Danyu Kong, Yueling Hao, Hongchang.
(A) Genotyping of the Lats2 and Cre alleles in the PyMT-derived cell lines (see primers location in Fig S2A). (A) Genotyping of the Lats2 and Cre alleles.
Gene expression profiles in tomato pedicels.
Han-Wei Shih, Cody L. DePew, Nathan D. Miller, Gabriele B. Monshausen 
Repression of MYBL2 by Both microRNA858a and HY5 Leads to the Activation of Anthocyanin Biosynthetic Pathway in Arabidopsis  Yulong Wang, Yiqing Wang,
MYB34, MYB51, and MYB122 Distinctly Regulate Indolic Glucosinolate Biosynthesis in Arabidopsis thaliana  Frerigmann Henning , Gigolashvili Tamara   Molecular.
Volume 4, Issue 2, Pages (March 2011)
Volume 10, Issue 7, Pages (July 2017)
MAX2 Affects Multiple Hormones to Promote Photomorphogenesis
PtrHB7, a class III HD-Zip Gene, Plays a Critical Role in Regulation of Vascular Cambium Differentiation in Populus  Yingying Zhu, Dongliang Song, Jiayan.
Live-cell imaging of transcriptional activation following TSA treatment. Live-cell imaging of transcriptional activation following TSA treatment. (A) Frames.
Volume 7, Issue 8, Pages (August 2014)
The Atg3bp1 mutants display enhanced disease resistance and alter classical MTI responses. The Atg3bp1 mutants display enhanced disease resistance and.
Volume 4, Issue 4, Pages (July 2011)
1O2-Mediated and EXECUTER-Dependent Retrograde Plastid-to-Nucleus Signaling in Norflurazon-Treated Seedlings of Arabidopsis thaliana  Chanhong Kim, Klaus.
Volume 2, Issue 1, Pages (January 2009)
Volume 7, Issue 12, Pages (December 2014)
Arabidopsis ROP1 and ROP6 Influence Germination Time, Root Morphology, the Formation of F-Actin Bundles, and Symbiotic Fungal Interactions  Yvonne Venus,
Volume 18, Issue 9, Pages (May 2008)
Mitochondrial Sulfide Detoxification Requires a Functional Isoform O- Acetylserine(thiol)lyase C in Arabidopsis thaliana  Consolación Álvarez, Irene García,
* Supplementary Fig. 1 (Yamanaka et al.) * * * ** ** ** * * **
Wang Long , Mai Yan-Xia , Zhang Yan-Chun , Luo Qian , Yang Hong-Quan  
ZTL interacts with CO and regulates its stability.
Volume 1, Issue 3, Pages (May 2008)
Linking Chloroplast Antioxidant Defense to Carbohydrate Availability: The Transcript Abundance of Stromal Ascorbate Peroxidase Is Sugar-Controlled via.
Presentation transcript:

Supporting information Figs S1-S5

Figure s1 Histochemical assay of root H 2 O 2 All of roots from seedlings grown in MS or containing 20 µM ABA for 12 days were stained by 3, 5-diaminobenzidine (DAB; Sigma) according to the method described by Du et al. (2008). Pictures were taken by a Leica stereomicroscope. Settings were identical for all the pictures in an experiment. Each experiment was repeated at least 5 times with similar results.

Figure s2 Histochemical assay of root O 2־ According to Dunand et al. (2007), the roots from Arabidopsis seedlings grown in MS or containing 20µM ABA for 12 days were stained by a solution of nitroblue tetrazolium (NBT) for 15 min in phosphate buffer (pH 6.1). Pictures were taken by a Leica stereomicroscope. Settings were identical for all the pictures in an experiment. Each experiment was repeated at least 5 times. According to Tsukagoshi et al. (2010), relative staining intensity was analyzed.

Figure s3 The transcriptional levels of RBOHD and RBOHF genes The mRNA of RBOHF and RBOHD were examined in Atmpk6-3 and WT root tissue by RT-PCR test. The method is same as stated in this manuscript. The primers are as follows. RBOHD: FP, 5′-TGTTTACCCCGGGAACGTGTTGTCTCTA-3′, RP, 5′-TTGCATCACCTTCCTCGTACACACTCGT-3 ′. RBOHF: FP, 5′-GCTCCGATTTCGCTCAATGCAT-3′, RP, 5′-AGCAGTCGAACCGAATAAGAACC-3 ′.

The transcriptional levels of PRX57 and PRX34 genes Analysis in RT-PCR showed the mRNA content of PRX57/34 in Atmpk6 mutant and WT root tissue. The method is same as stated. The primers are as follows. PRX34: FP, 5′-CTGCTTTGTTAATGGTTGTGACGC-3′, RP, 5′-TCGCTCTGGAT AAGACCTTTTCGC-3′; PRX57: FP, 5′- CGACTGTTTCGTTAAGGGCTGTGA-3′; RP: 5’- CAATGGACTCGACTGGTCTAGTGC-3’.

ABA-induced H 2 O 2 accumulation in the loss-of-function mutant prx34 (SALK_051769) seedling roots The test method was described in the section of Materials and methods. Figure s4

H 2 O 2 -elongated root cell in prx34 seedlings The test method was described in the section of Materials and methods.

Figure s5 The transcriptional levels of PM-located Ca 2+ transporters genes Analysis in RT-PCR showed the mRNA content of Ca 2+ transporters, including the glutamate receptors (GLRs) and the cyclic nucleotide gated channels (CNGCs), in Arabidopsis root tissue according to Vadassery et al. (2009). The method is same as stated. The gene-specific primers are as follows.

CNGC3 (FP: 5'-GAAGCC CGAGCGATTTTGTC, RP: 5'-GGTTTAAAGCAGCACCAGCC); CNGC10 (FP: 5'-TGTTTAGGTTCA AAGATGAAGGCA, RP: 5‘-ATCGCCAAAGCAACCACAC); CNGC15 (FP: 5'-ACCGGTGTTGTAACCGAGAC, RP: 5'-AGCTGAGGTTCTTCAAGCCC); CNGC20 (FP: 5'-CCTCGAACGCTCTTCTGTAAA, RP: 5'-CTAGTTATAG CCTTTAGTTTGTA); GLR1.3 (FP: 5'-GGCGGGAACTCGTTGTTAGA, RP: 5'-GGACTGTACACGAACACCGT); GLR2.5 (FP:5'-AGGAGGCCATCAGAGA GCTT, RP: 5'- AGCCAAAGCCATCAGCCTTA); GLR3.1 (FP: 5'- AACGTAGTG GCTTCCTCAGC, RP: 5'- CACCACATCTGACCAGCCAT).

Analysis in RT-qPCR showed the mRNA content of Ca 2+ transporters, including the glutamate receptors (GLRs) and the cyclic nucleotide gated channels (CNGCs), in Arabidopsis root tissue according to Vadassery et al. (2009). The method is same as stated. The gene-specific primers are as follows.

CNGC10 (FP: 5'- CTTGACGCGGTTTGCGATAG, RP: 5‘- GGATCTAATGCCCACGGGAG); CNGC15 (FP: 5'- CGACCCGGTTAACGAAATGC, RP: 5'- GCGTGTGGAAGACGGTAAGA); CNGC20 (FP: 5'- GATGCAATCCGTGAGAGGCT, RP: 5'- CGGGGTTTACAGAAGAGCGT); GLR1.3 (FP: 5'- TCACTAGTTCCAGCCTCCGA, RP: 5'- CCGAAACCGTTGGTGGTAGA); GLR2.5 (FP:5'- AACGGAAAGCTAGAGGCGAC, RP: 5'- CGCAGCTTCTTTGCGTTTGT); GLR3.1 (FP: 5'- CTTGGTGGTGGGTTGCTACT, RP: 5'- GCTGAGGAAGCCACTACGTT).

References: Du Y, Wang P, Chen J, Song CP Comprehensive functional analysis of the catalase gene family in Arabidopsis thaliana. Journal of Integrative Plant Biology 50: Dunand C, Crèvecoeur M, Penel C Distribution of superoxide and hydrogen peroxide in Arabidopsis root and their influence on root development: possible interaction with peroxidases. New Phytologist 174: Tsukagoshi H, Busch W, Benfey PN Transcriptional regulation of ROS controls transition from proliferation to differentiation in the root. Cell 143: