Mutations Curly winged fruit flies Drosophila, short leg bassett hounds and seedless grapes are all examples of mutations.

Slides:



Advertisements
Similar presentations
Mutations A mutation is a permanent change in the DNA or RNA sequence of a gene. There are two ways in which DNA can become mutated: 1.Mutations can be.
Advertisements

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)
Lesson Overview 13.3 Mutations.
FROM GENE TO PROTEIN: TRANSLATION & MUTATIONS Chapter 17.
12.4 MUTATIONS I. Kinds of Mutations
Genes as DNA: How Genes Encode Proteins
DNA Mutations Biology. What if we mess up one of the nucleotides and change one of the codons? We get a mutation! Mutations in DNA sequence: –Point mutations.
Human Genetic Mutations
 The sequences of bases in DNA are like the letters of a coded message… what would happen if a few of those letters changed accidentally, altering the.
Types of Mutations The power of the BASE!!. A MUTATION is a change in the DNA 1) Chromosomal Mutations – affect MANY genes ex. Down syndrome 2) ***Gene.
CHAPTER 7 Gene Experssion and Control Part 3. MUTATED GENES AND THEIR PRODUCTS  Mutations are changes in the sequence of a cell’s DNA.  If a mutation.
Mutations These are errors made in the DNA sequence that are inherited. These may have negative side effects, no side effects or positive side effects.
MUTATIONS.
Definition : Any change in the nucleotide sequence of DNA.
1. What are genetic disorders caused by. 2
Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.
What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...
13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
MUTATIONS How mistakes are made…. Mutations  Mutations are defined as “a sudden genetic change in the DNA sequence that affects genetic information”.
Human Genetic Mutations
NOTES – CH 17, part 2 DNA & MUTATIONS
Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.
DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.
Mutation – any change in DNA. Mutations Mutations are defined as “a sudden genetic change in the DNA sequence that affects genetic information”. They.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.
Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.
PROTEIN SYNTHESIS TRANSCRIPTION: DNA  m RNA TRANSLATION: m RNA  Protein.
1 & 2) Transcription vs. Translation  DNA  mRNA; nucleus  Making a protein; cytoplasm 3) How many tRNA nucleotides form an anticodon? 33.
12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.
GENETIC MUTATIONS What is this picture depicting?.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
Wild Type HeadMutant Head (Antennapedia). I. Proteins and Mutations: A. Some proteins carry out functions within the cells of an organism. B. Other proteins.
Name the 4 gene mutations that can occur State the effect of gene mutations on amino acid sequences.
PROTEIN SYNTHESIS TRANSCRIPTION: DNA  m RNA TRANSLATION: m RNA  Protein.
Protein synthesis continued.  Transcription is step 1  DNA  mRNA  Nucleus  RNA polymerase.
Because Stuff Happens. A. Mutation Overview  Any change or random error in the nucleotide sequence (either DNA or mRNA) is called a mutation  Can occur.
Do Now: What is a gene? A sequence of nucleotides
Mutations.
Mutations.
Copyright Pearson Prentice Hall
MUTATIONS And their effect.
DNA Mutations & Disorders
Gene Mutations.
MUTATIONS.
Human Genetic Mutations
Mutations.
MUTATIONS 12-4.
Mutations 5.4.
DNA- The Genetic Material
Human Genetic Mutations
Types of point mutations
To be successful today…
The DNA Code How does DNA affect living things?
Changes to the Genetic Code
Mutations.
Human Genetic Disorders
Mutations Ms MacCormack Fall 2018.
MUTATIONS.
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
Mutation, Natural Selection, and Artificial Selection
Copyright Pearson Prentice Hall
Unit 1 Human Cells Higher Human Biology for CfE Miss Aitken
DNA, RNA, and Proteins.
Mutations: Changes in Genes
Presentation transcript:

Mutations Curly winged fruit flies Drosophila, short leg bassett hounds and seedless grapes are all examples of mutations

Mutations- definition Mutation is a change or a mistake in DNA replication. Mutations can arise in from changes in individual genes or changes in the arrangement of genes on a chromosome

Types of mutations There are two types of genetic mutations Gene mutation point mutation chain termination mutation frameshift mutation chromosomal mutation

Point Mutation A point mutation is a single base pair change by physical or chemical means, where a nucleotide is replaced by a different type. A nucleotide can have a BASIC SUBSTITUTION of a base pair. Ex. Guanine changed to Adenine

Basic substitutions There can be three outcomes for a basic substitution 1) silent mutation- NO EFFECT ex. UCU, UCC, UCA, UCG are all the mRNA code for Serine amino acid. These changes would have no effect. Also there are many genes which do not have an effect on the body, a change in these genes would not cause a change

Basic substitutions Cont. 2) Neutral effect- A mutation that would change the structure of the protein but have little effect on its function 3) Drastic effect- a small change in one AA would seriously effect the structure and function of the protein ex. Sickle cell Anemia- a change in one AA changes the shape of the hemoglobin of the RBC

Deletion A deletion is when nucleotide is left out of a sequence of AA. Leaving out a nucleotide will cause a shift in the DNA and result in a synthesis of a polypeptide with an altered AA sequence.

Point mutations

Insertion Similar to deletion, a nucleotide inserted in a sequence can cause a mutation in the protein beyond the point of the extra nucleotide. In both deletion and insertion the polypeptide formed by the mutated gene, if one can be formed at all, is usually not functional.

Chain Termination Codon mutation There are three codons ( Three base pairs) that tell the AA to stop adding to the proteins - UAA, UAG, UGA. When tRNA sees this code it stops making the protein. If there is a change in one of these codons it will have a lethal effect since the protein will stop growing or continue to grow.

Chromosomal mutations Changes can occur in the chromosome as well as in the genes. Chromosomal mutations can happen in different ways. Ex. a piece of the chromosome may break off or lost during mitosis. Some of the chromosomal mutations can be repaired, others repair themselves in correctly.

Chromosomal mutations

Cancer We now know that normal cells can be transformed into malignant cancerous cells. Gene mutations are ultimately to blame. Mutant forms of genes, ONCOGENES, result in abnormal proteins that disrupt the normal reproduction of cells and cause cancer. Oncogenes can be caused by a number of ways- by carcinogens (cancer causing substance (smoking, chemicals ); UV or X-rays

Cancer pictures

Mental retardation A gene mutation responsible for a form of mental retardation affecting one in 600 males has been located on the X chromosome.

Mutation Disease- Sickle cell anemia One in 500 people of African decent has sickle cell anemia, which is a disease that changes the shape of the hemoglobin protein. There is just one nucleotide difference in the sequencing of this protein. These blood cells can block capillaries in the body and cause pain, fever or even strokes and paralysis. Most people don't live past 40 years of age.

Benefits of mutations Although most people think of mutations as harmful to or individual they can be helpful to an organism. Mutations of genes is cause of natural variation and one of the ways that organisms evolve. Gene mutations can have helpful results, allowing us to adapt to changes in the environment and survive as a species.

Examples of genetic diseases -Inherited or mutation Acute intermittent porphyria adult polycyctic kidney disease albinism alkaptonuria BRCA breast cancer cystic fibrosis down syndrome Duchenne muscular dystrophy fragile x syndrome hemophilia Huntington disease Neurofibromatosis Phenylketonuria Polyposis of the colon Sickle cell Anemia Tay-Sacs disease Thalassemia