10.4 Evidence of Evolution Evidence of Evolution.

Slides:



Advertisements
Similar presentations
Evidence for evolution in Darwin’s time came from several sources.
Advertisements

Evidence of Evolution Evolution is a continuous process of gradual modifications or changes in organisms. Patterns of evolution can be detected by viewing.
1. Biogeography-study of distribution of organisms around the world.
NGSSS SC.912.L.15.1* Explain how the scientific theory of evolution is supported by the fossil record, comparative anatomy, comparative embryology,
 Natural Selection-mechanism of change in populations. o Individuals with certain variations are likely to survive, reproduce, and pass these variations.
Lesson Overview 16.4 Evidence of Evolution.
EVIDENCE OF EVOLUTION CHAPTER 15-2.
EVIDENCE OF EVOLUTION Chapter 15-2 Unit 8 Part 2: Notes #1
Evidence for Evolution. Fossil Record Shows gradual changes in organisms over time Has some major gaps –Caused by: Conditions have to be just right for.
Evidence for evolution in Darwin’s time came from several sources.
Lesson Overview 16.4 Evidence of Evolution.
Give me some proof! Evidence for Evolution. 1. Studies of Fossils What are Fossils? –Fossils are any trace of dead organisms.
Evidence of Evolution. What is evolution? Definition: – The gradual change in a species over time Takes a Looooong time Results from a change in the GENETIC.
Evidence for Evolution.  Supported by evidence gathered over a century  Evidence must be gathered to support the theory of evolution- THE THEORY CANNOT.
Evidence of Evolution. 1.Fossil Record 2.Homologous Body structures 3.Similarities in Embryology 4.Biochemical Evidence.
KEY CONCEPT There were theories of biological and geologic change before Darwin Early Ideas About Evolution.
Evidence for Descent with Modification. 1. Direct Observation Guppy coloration HIV resistance.
Evidence for evolution in Darwin’s time came from several (four) sources.
10.4 Evidence of Evolution 1 Evolutionary Time Scales Long time scale events that create and destroy species. Macroevolution: Long time scale events that.
10.4 Evidence of Evolution KEY CONCEPT Evidence of common ancestry among species comes from many sources.
10.4 Evidence of Evolution KEY CONCEPT Evidence of common ancestry among species comes from many sources.
Evidence for Evolution
Evidence for Evolution
Evidence for evolution in Darwin’s time came from several sources.
Evidences for Evolution. 1. Structural Adaptations –Physical appearance change that increases an organism’s survival –Examples: Mimicry – trying to look.
Fossils: Lines of descent Biogeography Anatomical Structures Embryology Chemical: DNA and proteins * why evolution is awesome.
Evidence for Evolution  Fossil Record  Comparative Anatomy  Comparative Embryology  Genetics-DNA  Industrial Melanism.
10.1 Early Ideas About Evolution
Biological Evidence of Evolution
Evidence for evolution in Darwin’s time came from several sources.
Evidence for evolution in Darwin’s time came from several sources.
Evidence that supports evolution
Comparative Anatomy Notes
Evidence for evolution in Darwin’s time came from several sources.
(Supported by 5 branches of science)
Evidence of Evolution Key Concept
Evidence for evolution in Darwin’s time came from several sources.
KEY CONCEPT Evidence of common ancestry among species comes from many sources. This star-nosed mole has a pink snout that is especially good at finding.
Determining Relatedness
Evidence of Evolution There is evidence of evolution in 5 major fields of science: Paleontology: the study of prehistoric life Biogeography: where living.
Evidence for evolution in Darwin’s time came from several sources.
Evidence of Evolution review
Evidence for evolution in Darwin’s time came from several sources.
Evidence for Evolution
Of Evolution.
Objectives Recognize the major sources of evidence for evolution.
EVIDENCE OF EVOLUTION CHAPTER 15-2.
Unit 7: Evidence for Evolution
Evidence for evolution in Darwin’s time came from several sources.
Bio Do Now Get out natural selection lab
Evidence for evolution in Darwin’s time came from several sources.
Evidence for evolution in Darwin’s time came from several sources.
Evolution Part 2 Evidence & Types.
Evidence for Evolution
Determining Relatedness
Evidence for evolution in Darwin’s time came from several sources.
Types of Adaptations Structural Adaptation: Affect the changes in structure of the body (skin color, shape etc.) Physiological Adaptation: Affect the.
Evidence for Evolution
Evidence of Evolution There is evidence of evolution in 5 major fields of science: Paleontology: the study of prehistoric life Biogeography: where living.
EVIDENCE OF EVOLUTION Chapter 15-2.
Structural evidence: Embryonic similarities Vestigial organs
Evidence for evolution in Darwin’s time came from several sources.
Evidence for evolution in Darwin’s time came from several sources.
Evidence for Evolution
Evidence for evolution in Darwin’s time came from several sources.
Evidence for evolution in Darwin’s time came from several sources.
Evidence for evolution in Darwin’s time came from several sources.
#78 Analogous, homologous, and vestigial structures
EVIDENCE OF EVOLUTION Chapter 15-2.
Evidence for evolution in Darwin’s time came from several sources.
Presentation transcript:

10.4 Evidence of Evolution Evidence of Evolution

10.4 Evidence of Evolution The Fossil Record Comparing fossils with living organisms reveals a pattern of gradual change from past to present. *We will never find fossils of every species that ever lived.

10.4 Evidence of Evolution Biogeography Study of the locations of organisms around the world Ostrich (Africa) Emu (Australia) Rhea (South America)

10.4 Evidence of Evolution Movement of land forms can separate a group of organisms into two separate groups

10.4 Evidence of Evolution

Embryology Scientists compare embryos to look for similar patters and structures

10.4 Evidence of Evolution Anatomy Scientists compare body structures of different species –Homologous structures are similar in structure but different in function. –Evidence of a common ancestor

10.4 Evidence of Evolution Human hand Bat wing Mole foot Fly wing –Analogous structures are not evidence of a common ancestor. –Analogous structures have a similar function.

10.4 Evidence of Evolution Vestigial structures are remnants of organs or structures that had a function in an early ancestor. (Ostrich wings, wisdom teeth, appendix, whale pelvic/leg bones)

10.4 Evidence of Evolution Biochemistry Comparing genes between species AGTCCCGTAGGTCGATGTGGGTAAAAGCTTGATCG AGTCCCGTACGTCGATGTGGGTATAAGCTTGATCG

10.4 Evidence of Evolution How similar is human DNA to a…? 98% 50%