Chap. 1 basic concepts of Molecular Biology Introduction to Computational Molecular Biology Chapter 1

1.1 Life IN nature we find both living and nonliving things. Living things Move, reproduce, grow, ate, and so on. The main actors in the chemistry of life are molecules called proteins and nucleic acids. Nucleic acids encode the info. necessary to produce proteins.

1.2 Proteins Most substances in our bodies are proteins. Enzymes act catalysts of chemical reactions. Usually a given enzyme can help only one kind of biochemical reaction. Proteins are polypeptidic chains. The amino group ->The carboxy group

1.3 Nucleic Acids Living organisms contain two kinds of nucleic acids ribonucleic acid & deoxyribonucleic acid DNA is a chain of simpler molecules. There are four kinds of bases Adenine(A), guanine(G), cytosine(C), thymine(T)

1.3 DNA DNA molecule having 200 bases or 200 nucleotides. DNA molecules in nature are very long. Based A and T said to be the complement of each other, or a pair of complementary bases. The 3’ end of one strand corresponds to the 5’ end of the other strand. DNA is found inside the nucleus and in cell organelles called mitochondria and chloroplasts.

1.3 RNA In RNA we do not find thymine(T); instead, uracil(U) is present. RNA does not form a double helix. Sometimes we see RNA-DNA hybrid helices. The mRNA will then be used in cellular structures called ribosomes to manufacture a protein rRNA Ribosomes are made of proteins and a form of RNA called rRNA tRNA Actually implement the genetic code in a process called translation.

1.4 Genes and the genetic code Each cell of an organism has a few very long DNA molecules. Important thing of DNA To encode information for building proteins. Each nucleotide triplet is called a codon 64 possible nucleotide triplets Special termination codons = STOP Signals the start of a gene = Methionine

1.4 The genetic code mapping codons to amino acids First Position Second position Third position GACU G Gly Glu Asp Ala Val GACUGACU A Arg Ser Lys Asn Thr Met Ile GACUGACU C Arg Gln His Pro Leu GACUGACU U Trp STOP Cys STOP Tyr Ser Leu Phe GACUGACU

1.4 Transcription, translation, & protein synthesis Replication Transcription Reverse Transcription Translation DNARNAProtein

1.4 CHROMOSOMES The number of chromosomes in a genome is characteristic of a species. The complete set of chromosomes inside a cell is called a genome. Species Number of Chromosomes (diploid) Genome Size (base pairs) Bacteriophage λ (virus) Escherichia coli (bacterium) Saccharomyces cerevisiae (yeast) Caenorhabditis elegans (worm) Drosophila melanogaster (fruit fly) Homo sapiens (human) X X X X X X 10 9

1.5 How the Genome Is Studied Maps and sequences A human chromosome has around 10 8 bps. Locus : the location of a gene in a chromosome. DNA cloning Recombination New gene arrangements can form. There are an enormous number of recombination possibilities. Cutting DNA EcoRI is a restriction enzyme that cuts DNA wherever the sequence GAATTC is found.

1.5 Maps AND Sequences CGCACACCGACGTCATTCTCATGTGCTTCTCGGCACA Clones Chromosome Genetic linkage map (works on bp range) Physical map (works on bp range) Sequencing (works on bp range) The different levels at which a genome is studied.

1.5 Specific Techniques Cutting and Breaking DNA The pair of scissors is represented by restriction enzymes. Shotgun method DNA molecules can be broken apart by the shotgun method. Each individual molecule breaks down at several random places, and then some of the fragments are filtered and selected for further processing. In particular for copying or cloning.

1.5 Specific Techniques Cutting DNA Using EcoRI (restriction enzyme) A T C C A G A A T T C T C G G A T A G G T C T T A A G A G C C T A T C C A G A A T T C T C G G A T A G G T C T T A A G A G C C T CUT

1.5 Specific Techniques Copying DNA We insert this piece (given a piece of DNA) into the genome of an organism, a host or vector, and then let the multiplied along with the original DNA. Popular vectors : plasmids, cosmids, phages,… I.R. is a field that has focused on query and transaction processing of structured data. Information retrieval and database systems each handle different kinds of data. Reading and Measuring DNA Reading is done with a technique known as gel-electrophoresis

1.5 Specific Techniques Copying DNA Using plasmids for cloning

1.5 Specific Techniques Polymerase Chain Reaction A way of producing many copies of a DNA molecule without cloning it is afforded by the polymerase chain reaction(PCR). DNA Polymerase is an enzyme that catalyzes elongation of a single strand of DNA. PCR consists basically of an alternating repetition of two phases Double stranded DNA is separated into two single strands by heat. Each single strand is converted into a double strand by addition of a primer and polymerase action.

1.5 Specific Techniques Polymerase Chain Reaction Pre-PCR status Denaturation Annealing Extension

1.6 The Human Genome Project The Human Genome Project is a multinational effort, begun in 1988, whose aim is to produce a complete physical map of all human chromosomes, as well as the entire human DNA sequence.

1.6 The Human Genome Project Schematic view of film produced by gel electrophoresis GACTTAGATCAGGAAACTGACTTAGATCAGGAAACT G A T C