Combinatorial Chemistry. Synthesis of many structures (diversity) combinatorial technology, combinatorial library molecular diversity What is Combinatorial.

Slides:



Advertisements
Similar presentations
1 Real World Chemistry Virtual discovery for the real world Joe Mernagh 19 May 2005.
Advertisements

The Drug Discovery Process
Combinatorial Technology Supervisory Patent Examiner
Analysis of High-Throughput Screening Data C371 Fall 2004.
D9 – Drug Design (HL). D.9.1 Discuss the use of a compound library in drug design  Over the years, molecules of various substances have been isolated.
Drug design.  electronic databases  contain molecules which have been isolated or synthesized and tested by pharmaceutical companies for possible pharmaceutical.
Department Author Lead-like Properties, High- throughput Screening and Combinatorial Library Design Andy Davis, Simon Teague, Tudor Oprea, John Steele,
Jürgen Sühnel Institute of Molecular Biotechnology, Jena Centre for Bioinformatics Jena / Germany Supplementary Material:
Drug Discovery The use of solid phase combinatorial chemistry and parallel synthesis.
 Used extensively in relation with drug discovery  Principle of Combinatorial Chemistry ◦ Generation of Compound Libraries from Molecular Building blocks.
Jeffery Loo NLM Associate Fellow ’03 – ’05 chemicalinformaticsforlibraries.
Phage Display and its Applications Matt Brown Human Genetics Dr. Nancy Bachman.
Luddite: An Information Theoretic Library Design Tool Jennifer L. Miller, Erin K. Bradley, and Steven L. Teig July 18, 2002.
Biol518 Lecture 2 HTS and Antibiotic Drug Discovery.
2DS01 Statistics 2 for Chemical Engineering lecture 5.
Peptides in chemistry and biology 1.Phage display 2.Solid phase peptide synthesis and applications of synthetic libraries 3.Native chemical ligation in.
Microarrays: Basic Principle AGCCTAGCCT ACCGAACCGA GCGGAGCGGA CCGGACCGGA TCGGATCGGA Probe Targets Highly parallel molecular search and sort process based.
Bioinformatics Ayesha M. Khan Spring Phylogenetic software PHYLIP l 2.
Advanced Medicinal Chemistry
GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTAC CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG
Computational Techniques in Support of Drug Discovery October 2, 2002 Jeffrey Wolbach, Ph. D.
Combinatorial Chemistry and Library Design
Asia’s Largest Global Software & Services Company Genomes to Drugs: A Bioinformatics Perspective Sharmila Mande Bioinformatics Division Advanced Technology.
An Introduction to Medicinal Chemistry 3/e COMBINATORIAL CHEMISTRY
Biotechnology in Medicine Chapter 12.
EXPLORING CHEMICAL SPACE FOR DRUG DISCOVERY Daniel Svozil Laboratory of Informatics and Chemistry.
1 Combinatorial Synthesis and Drug Discovery Random Search e.g., buying paintbrush, mop, hammer, gluestick, nail, etc. etc. for hanging a picture frame.
Chapter 3. Basic Principles of Drug Design III
Daniel Brown. D9.1 Discuss the use of a compound library in drug design. Traditionally, a large collection of related compounds are synthesized individually.
D9 Drug design Compound libraries Combinatorial and parallel chemistry
Drug design.  electronic databases  contain molecules which have been isolated or synthesized and tested by pharmaceutical companies for possible pharmaceutical.
Faculté de Chimie, ULP, Strasbourg, FRANCE
1 © Patrick An Introduction to Medicinal Chemistry 3/e Chapter 14 COMBINATORIAL CHEMISTRY Part 2: Sections 14.5 – 14.6.
WANG HANLU Advance in research of aptamers and related drugs.
Drug Design Geometrical isomerism Chirality
Drug Discovery Process Massimiliano Beltramo, PhD.
Combinatorial Chemistry Advanced Medicinal Chemistry (Pharm 5219): Section A Ref.: An Introduction to Medicinal Chemistry, 3 rd ed. 2005, G.L.Patrick,
Synthesis Make me a molecule Chemistry Biology Materials.
Page 1 SCAI Dr. Marc Zimmermann Department of Bioinformatics Fraunhofer Institute for Algorithms and Scientific Computing (SCAI) Grid-enabled drug discovery.
Introduction Over the last decade, solid phase synthesis and combinatorial chemistry have undergone major evolution. In the early years, the process of.
DEFINITION The automated synthesis of a large number of compounds in a short time period using a defined reaction route and a large variety of reactantsThe.
A Computational Method for Property Prediction Design and Discovery of Optimal Molecular Scale Solar Antennas Sofia Izmailov Princeton University Chemistry.
Vigdis Lauvrak Bio H2003 Phage display.
1 DRUG DISCOVERY Random Search e.g., buying paintbrush, mop, hammer, gluestick, nail, etc. etc. for hanging a picture frame on the wall Rational Design.
Identification of structurally diverse Growth Hormone Secretagogue (GHS) agonists by virtual screening and structure-activity relationship analysis of.
Computational Approach for Combinatorial Library Design Journal club-1 Sushil Kumar Singh IBAB, Bangalore.
Dr. Horst Hemmerle Eli Lilly & Company Director Lead Generation Technologies: Responsible for: Compound Collection Enrichment Strategy Screening Strategies.
What is phage display? An in vitro selection technique using a peptide or protein genetically fused to the coat protein of a bacteriophage.
CATEGORY: EXPERIMENTAL TECHNIQUES Polymerase Chain Reaction (PCR) Tarnjit Khera, University of Bristol, UK Background The polymerase chain reaction (PCR)
신기술 접목에 의한 신약개발의 발전전망과 전략 LGCI 생명과학 기술원. Confidential LGCI Life Science R&D 새 시대 – Post Genomic Era Genome count ‘The genomes of various species including.
Molecular Modeling in Drug Discovery: an Overview
Combinatorial Chemistry
Structural Bioinformatics in Drug Discovery Melissa Passino.
Combinatorial chemistry
Custom peptide synthesis services In the quantitative proteomics research, several MS-based methodologies for relative quantification have been introduced.
Drug Design Geometrical isomerism Chirality
iGEM Meeting – 19/04/17: SELEX & Riboswitches
DRUG DISCOVERY: FINDING A LEAD
Introduction of Combinatorial Chemistry
Phagemid library Creative Biolabs is one of the well-recognized experts who is professional in applying advanced phage display technologies for a broad.
Phage library panning Creative Biolabs is one of the well-recognized experts who is professional in applying advanced phage display technologies for a.
2nd Lecture Comb Chem. 5th Year Pharmacy
Process of Drug Discovery
“Structure Based Drug Design for Antidiabetics”
Statistics 2 for Chemical Engineering lecture 5
Separation Methods: Review of Mixtures
Combinatorial peptide library methods for immunobiology research
ORGANIC PHARMACEUTICAL CHEMISTRY IV
Presentation transcript:

Combinatorial Chemistry

Synthesis of many structures (diversity) combinatorial technology, combinatorial library molecular diversity What is Combinatorial Chemistry? A synthetic strategy which leads to a large set of compounds. Product of matrix chemistry (systematic synthesis ) Automation of synthesis (speed)

Why do we need Combinatorial Chemistry ? 1. From New Drug discovery --- biodiversity drug design 2. From Genome Project --- post-Genome Era more new drug targets

Issues : ! Human Diversity Customized Drug ! Possible Targets Too many Solutions for Lead Compound Search : 1. Existing Sample collection :a. Natural Sources scarce b. Drug Design lead to homogeneous & specific sets of compounds. 2. De Novo Design Too many unexpected & complicated synthesis 3. Combinatorial Chemistry Drug Development of 21st Century

Drug-like Compounds How Many We Want from Combinatorial Chemistry possible combination of drug like compounds : ~ synthesizable number of compounds : ~ Practical number of compounds in a library : 10 6 with design < 10 3 with virtual screening, virtual library Solution (?) -- Combination of Design & Informatics

’70 : Natural Products ’80 : Rational Design ’90 : Combi. Chem.& HTS ’00 : Information Guided Design Rational Design Diverse Design Serendipity ( immune system) Paradigm Shift of Drug Development

1. Nature does it all the time. -- can we mimic mother nature ? 2. Are there ways to automate the synthesis ? -- Immune System – Molecular Diversity -- Peptide synthesizer : 40 min./cycle -- DNA synthesizer : 1.5 min./cycle 3. Are there ways to generate many compounds at a time ? Combinatorial Chemistry

-- Peptide synthesizer : 40 min./cycle -- DNA synthesizer : 1.5 min./cycle Solid Phase Organic Synthesis solid phase synthesis : needs optimization for every new reaction Time required to develop a combinatorial chemistry : months : Size of the combinatorial library Purpose of the library : General Library Lead Search SAR Construction Target Area

1.Mixture Library a. SELEX -- nucleotide library n b. Positional scanning -- peptide library n c. Phage Display -- peptide library d. Split- mix method ( bead tech.) -- general e. simple mixture Combinatorial Chemistry : Strategy

SELEX(Systematic Evolution of Ligands by Exponential Enrichment)

2. Matrix Library a. Pin Technology b. Chip Technology c. Parallel Array synthesis Combinatorial Chemistry : Strategy

Multicomponent Reaction 1. Passerini reaction 2. Ugi reaction

Multicomponent Reaction 3. Hantzsch reaction