BTY328: Virology Dr William Stafford Viral characteristics and isolation-Lecture 1&2 Origin and diversity of viruses?-Tutorial Viral Hosts and infection- Lecture 3&4

What are viruses? Viruses are genetic elements that can replicate independently of a cell's chromosomes, but not independently of cells themselves. In order to multiply, viruses require a cell in which they can replicate. Such a cell is called a host. Viruses are characterized by also having an extracellular state.

The nature of viruses Viruses have both an extracellular and an intracellular state. In the extracellular state, the virus particle, or virion, is metabolically inert and does not carry out biosynthetic functions. The virion is the structure by which the virus genome is carried from the cell in which it has been produced to another… Upon infection of a host cell (intracellular state), replication of the virus genome occurs, as well as other components that make up the virus coat.

Effects of viral infection? Viruses may replicate themselves within a host in such a way that is destructive to the host cell and causes disease (cell destruction and immune response). The genetic material may also be integrated into the genome and thereby causes genetic changes to the cell that are inheritable.

Viral Properties Viruses vary widely in size and shape. Viruses are smaller than cells, ranging in size from 0.02 to 0.3 um. Viral genomes are very limited in size, since they encode only functions that they cannot acquire from their hosts. During viral infection the virus redirects preexisting host machinery and metabolic functions necessary for virus replication. Most bacterial genomes are between 1000 and 9000 kbp, with the smallest known being about 590 kbp. and the largest known (Vaccinia), is only 190 kbp.

Viral Structure The structures of virions are diverse, varying widely in size, shape, and chemical composition. The nucleic acid of the virion is always located within the particle, surrounded by a protein coat called the capsid. The protein coat is always formed of a number of individual protein molecules which are arranged in a precise and highly repetitive pattern Viruses can be either naked capsid or have a viral envelope (outer membrane layer)

Naked capsid and enveloped viruses The virus envelope consists of a lipid bilayer with (glyco)proteins, embedded in it. Naked capsid- genetic material surrounded by proytein core Naked CapsidEnvelope Virion

From Medical Microbiology, 5 th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig Basic virus structure

Viral structure and symmetry Some capsids are icosahedral in shape. Pentamers are at the vertices of the icosahedron, whereas hexamers form its edges and triangular faces. The icosahedron is a regular polyhedron with 20 equilateral triangular faces and 12 vertices. Other capsids are helical and shaped like hollow protein cylinders, which may be either rigid or flexible Many viruses have an envelope, an outer membranous layer surrounding the nucleocapsid. Enveloped viruses have a roughly spherical but somewhat variable shape even though their nucleocapsid can be either icosahedral or helical. Complex viruses have capsid symmetry that is neither purely icosahedral nor helical. They may possess tails and other structures (e.g., many bacteriophages) or have complex, multilayered walls surrounding the nucleic acid (e.g., poxviruses such as vaccinia).

Basic virus structure

From Medical Microbiology, 5 th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig Structures compared

RNA and DNA viruses + and - Viruses divided into two basic types based on whether they have DNA or RNA as their genetic material. However, there is a third group of viruses that use both DNA and RNA as their genetic material but at different stages of their reproductive cycle. eg retroviruses-RNA genome in the virion but replicates through a DNA intermediate, In contrast, the human hepatitis B contains DNA in the virion but has an RNA intediate in replication. T These viral classes can be further divided according to whether the nucleic acid in virion is single- or double- stranded and whether the + or - strand is used…

Virus classification and replication

Virus Groups and Their Characteristics

Virus replication

Replication themes

M K A K L L V L L C A L A A T D A D T I F1 * R Q N Y W S C Y V H L Q L Q M Q T Q Y F2 E G K T T G P V M C T C S Y R C R H N M F3 5’ atgaaggcaaaactactggtcctgttatgtgcacttgcagctacagatgcagacacaata 3’ ----:----|----:----|----:----|----:----|----:----|----:----| 3’ tacttccgttttgatgaccaggacaatacacgtgaacgtcgatgtctacgtctgtgttat 5’ X F A F S S T R N H A S A A V S A S V I F6 X S P L V V P G T I H V Q L * L H L C L F5 H L C F * Q D Q * T C K C S C I C V C Y F4 + and - RNA sense RNA viruses package + polarity RNA in virions as genome. This + sense RNA can be translated directly into protein upon uncoating of the virion in the cell - sense RNA viruses package - polarity RNA in virions as genome. This - sense RNA must be transcribed by a virus coded, virion packaged RNA dependent RNA polymerase immediately following uncoating.

M K A K L L V L L C A L A A T D A D T I F1 * R Q N Y W S C Y V H L Q L Q M Q T Q Y F2 E G K T T G P V M C T C S Y R C R H N M F3 5’ atgaaggcaaaactactggtcctgttatgtgcacttgcagctacagatgcagacacaata :----|----:----|----:----|----:----|----:----|----:----| 3’ tacttccgttttgatgaccaggacaatacacgtgaacgtcgatgtctacgtctgtgttat 60 X F A F S S T R N H A S A A V S A S V I F6 X S P L V V P G T I H V Q L * L H L C L F5 H L C F * Q D Q * T C K C S C I C V C Y F4 C I G Y H A N N S T D T V D T L L E K N F1 V * A T M R T T Q P T L L T H Y S R R M F2 Y R L P C E Q L N R H C * H T T R E E C F3 61 tgtataggctaccatgcgaacaactcaaccgacactgttgacacactactcgagaagaat 3’ ----:----|----:----|----:----|----:----|----:----|----:----| 61 acatatccgatggtacgcttgttgagttggctgtgacaactgtgtgatgagctcttctta 5’ H I P * W A F L E V S V T S V S S S F F F6 I Y L S G H S C S L R C Q Q C V V R S S F5 T Y A V M R V V * G V S N V C * E L L I F4 Correct initiation codon and strand required for protein production (ORF)‏

Classification of Viruses (human)- characteristics

Classification of Viruses (human)- hosts and disease

Virus growth Infection (eclipse: no infective virions). Replication occcurs during latent phase, and viral progey spread to other cells resulting in production of many infective virions… Different latent periods for different viruses

Summary: Viruses are obligate intracellular parasites Viruses are obligate intracellular parasites Structure Structure Nucleic acid in a protein shell, with/without lipid envelope (naked capsid and envelope virus)‏ Nucleic acid in a protein shell, with/without lipid envelope (naked capsid and envelope virus)‏ Structure has symmetry Structure has symmetry Many virus families, organized by characteristics and host biology Many virus families, organized by characteristics and host biology Replication Replication Generic scheme- Varying strategies depending on nucleic acid (RNA/DNA, and +/-)‏ Generic scheme- Varying strategies depending on nucleic acid (RNA/DNA, and +/-)‏