Transcription and Translation
Genes: are segments of DNA that code for proteins Most nucleotide base sequences in DNA don’t code for anything ATGCGAATCGTAGCATACGATGCATGCACGTG CATGCTTTTAGCAGCATGCAGCATGCAGCTAT ACGATAGCTAGCTAGCTCGATGCATGCATCGA TGCTAGCATGCTAGCTAGCATGCATGCATGCA CGTTATCGTTAAATTTTTCTTGGGTTAATTGGG
Is the process that opens up a gene coding portion of DNA and makes a copy (transcript) of the base sequences to go on and make a protein Transcription can be broken down into 3 simple steps
The process of transcription begins as the enzymes (helicase) unzip the DNA in the region of the gene that will be copied (transcribed)
RNA Polymerase binds to the DNA and begins forming base pairs with the complementary bases of DNA The transcript of DNA it makes is called mRNA
Is a segment of copied DNA that codes for a protein mRNA has 3 differences with DNA ◦ 1. mRNA’s sugar is ribose ◦ 2. mRNA’s is single stranded ◦ 3. mRNA doesn’t have thymine (T) as a base pair, instead is has Uracil ◦ SO… G still binds to C ◦ But.. A binds to U in mRNA
So RNA polymerase matches the correct bases from the DNA, let’s practice RNA polymerase’s job IF DNA had this nucleotide sequence, what sequence will the mRNA have? ATTGCCTTGGAATCCGTCA---DNA UAACGGAACCUUAGGCACU---mRNA
The mRNA stand breaks away from the DNA and leaves the nucleus of the cell and enters the cytoplasm The DNA strands rejoin each other
Transcription makes a copy of nucleotide bases from DNA that serve as a code for making proteins ◦ So the code is written in a sequence of bases Proteins are long chains of Amino Acids ◦ So the code of a protein is the sequence of aminoacids Translation from bases to amino acids is the next step to building a protein
How does the mRNA base sequence code for the 20 common amino acids it needs to build a protein? Each set of 3 bases in a row codes for differing amino acids, a set of 3 is called a codon ◦ Each codon codes for differing amino acids
All sequences start with AUG
Recall that ribosomes are found in both the nucleus and cytoplasm, and they are responsible for making protiens mRNA that has been transcribed is moved out of the nucleus to the cytoplasm where a ribosome will bind to it and begin making a protein from the mRNA code
Can be broken down into 5 simples steps
Ribosome attaches to the mRNA strand in the cytoplasm Molecules of tRNA, each carrying a specific amino acid, approach
Is a specialize strand of RNA that binds to a specific amino acid and also has a anticodon region that complements a mRNA strand to attach the correct amino acid to make a protein So if the mRNA has the codon GCU the anticodon in tRNA will be CGA
The start Codon AUG, which codes for the amino acid methionine, is found on the mRNA strand A tRNA carrying methionine attaches to the ribosome and mRNA strand
A tRNA molecule matching the next codon in the mRNA comes in and binds to the ribosome and mRNA The methionine and the new amino acid just brought in attach to each other via a peptide bond
After the peptide bond is formed, the ribosome slides along the mRNA strand to the next codon The first tRNA is released (no longer carrying the amio acid methionine) A new tRNA comes in a brings the correct amino acid
The process continues to repeat, forming a chain of amino acids, until a stop codon is reached Then the ribosome releases the new protein, which can now fold and become functional