Codon usage bias Ref: Chapter 9 Xuhua Xia dambe.bio.uottawa.ca

Xuhua Xia Slide 2 Objectives Understand how codon usage bias affect translation efficiency and gene expression Biomedical relevance –Protein drugs in pharmaceutical industry –Transgenic experiments in agriculture Factors affecting codon usage bias Indices measuring codon usage bias Develop bioinformatic skills to study the genomic codon usage.

Xuhua Xia Slide 3 Codon Usage Bias Observation: Strongly biased codon usage in a variety of species ranging from viruses, mitochondria, plastids, prokaryotes and eukaryotes. Hypotheses: –Differential mutation hypothesis, e.g., Transcriptional hypothesis of codon usage (Xia 1996 Genetics 144: ) –Different selection hypothesis, e.g., (Xia 1998 Genetics 149: 37-44) Predictions: –From mutation hypothesis: Concordance between codon usage and mutation pressure –From Selection hypothesis: Concordance between differential availability of tRNA and differential codon usage. The concordance is stronger in highly expressed genes than lowly expressed genes (CAI is positively correlated with gene expression). UCC~tRNA~Gly GCC~tRNA~Gly UCC~tRNA~Gly Polycistronic mRNA Ribosome Gene 1 Gene 2 Gene 3 RNA polymerase Protein

Xuhua Xia Slide 4 Table 9-2, yeast Xia Bioinformatics and the cell.

Xuhua Xia Slide 5 Conflict: Initiation and Elongation Met codon usage from the 12 CDSs: AUA214 AUG 37 Possible tRNA Met/CAU, tRNA Met/UAU Vertebrate mitochondrial genome has only one tRNA Met. Which one to have? –tRNA Met/CAU : Good for initiation, but not efficient for AUA codons even with the C modified to 5-formylcytidine –tRNA Met/UAU : Good for AUA codons, but not good for initiation. –anticodon: CAU favoring the AUG codon Nature has chosen CAU: All mitochondrial genomes with a single tRNA Met has a CAU anticodon. Problem with AUA codons in translation? Xia et al PLoS One

Xuhua Xia Slide 6 Hypothesis and Predictions MetLeuGluLysGlnArgTrp AUAUUAGAAAAACAAAGAUGA Favoured by mutation, but not by tRNA- mediated selection because the first (wobble) position in tRNA anticodon is C. Favoured by mutation Also favoured by tRNA-mediated selection: the first (wobble) position of tRNA is U. Predictions: 1. Proportion of A-ending codons (or RSCU) should be smaller in the Met codon family than in other R-ending codon families: P NNA = N NNA /N NNG 2. Availability of tRNAMet/UAU should increase P AUA.

Xuhua Xia Slide 7 Selection against AUA codons Carullo, M. and Xia, X J Mol Evol 66:484–493.

Xia, X In: RS Singh et al.. Evolution in the fast lane: Rapidly evolving genes and genetic systems. Oxford University Press. Fig. 5. Relationship between P AUA and P UUA, highlighting the observation that P AUA is greater when both a tRNA Met/CAU and a tRNA Met/UAU are present than when only tRNA Met/CAU is present in the mtDNA, for bivalve species (a) and chordate species (b). The filled squares are for mtDNA containing both tRNA Met/CAU and tRNA Met/UAU genes, and the open triangles are for mtDNA without a tRNA Met/UAU gene.

Xuhua Xia Slide 9 Calculation of RSCU RSCU is codon-specific RSCU and proportion: Different scaling.

Xuhua Xia Slide 10 Calculation of CAI Compound 6- or 8-fold codon families should be broken into two codon families CAI is gene-specific. 0  CAI  1 CAI computed with different reference sets are not comparable. Problem with computing w as F i /F i.max : Suppose an amino acid is rarely used in highly expressed genes, then there is little selection on it, and the codon usage might be close to even, with w i  1. Now if we have a lowly expressed gene that happen to be made of entire of this amino acid, then the CAI for this lowly expressed gene would be 1, which is misleading. There has been no good alternative. Further research is needed. N 2,3,4 : Number of 2-, 3-, 4-fold codon families

Xuhua Xia Slide 11 Weak mRNA predictive power y = x R 2 = mRNA abundance Protein abundance FRS2 ENO1

Xuhua Xia Slide 12 Effect of Codon Usage Bias y = x R 2 = Codon usage bias Protein abundance FRS2 ENO1

Xuhua Xia Slide 13 Problems with CAI Formulation –Reference set –w = 0 Implementation –AUG –UGG –Multiple codon families for one amino acid Dependence on AT% Solutions (Xia, X Evolutionary Bioinformatics)

Xuhua Xia Slide 14 RSCU (HIV-1 vs Human) Fig. 1. Relative synonymous codon usage (RSCU) of HIV- 1 compared to RSCU of highly expressed human genes. Data points for codons ending with A, C, G or U are annotated with different combinations of colors and symbols. A-ending codons exhibit strong discordance in their usage between HIV-1 and human and are annotated with their coded amino acids. van Weringh et al MBE.

Xuhua Xia Slide 15 Research Observation on HIV-1: –Strong surplus of A-ending codon –High mutation rate Hypothesis: Strong A-biased mutation disrupting codon adaptation. –Prediction: Strong A-biased mutation (confirmed) If mutation rate is lower, then there will be better codon adaptation (The related HTLV-1 parasitizes the same cell as HIV-1, but have lower mutation rate: HTLV-1 genes should exhibit better codon adaptation)

Xuhua Xia Slide 16 RSCU (HTLV-1 vs Human) Relative synonymous codon usage (RSCU) of HTLV-1 compared to RSCU of highly expressed human genes. Data points for codons ending with A, C, G or U are annotated with different combinations of colors and symbols. A-ending codons exhibit strong discordance in their usage between HIV-1 and human and are annotated with their coded amino acids.

Table 2. Frequency of A residues, length and codon adaptation index (CAI) for the three HIV-1 early (tat, rev and nef) and five late (gag-pol, vif, vpu, vpr, and env) coding sequences (CDS). Gene CDS (bp) CAI tat rev nef gag pol vif vpr vpu env Any problem with the mutation hypothesis?