MOLECULAR PHYLOGENETICS Four main families of molecular phylogenetic methods :  Parsimony  Distance methods  Maximum likelihood methods  Bayesian methods.

Slides:

Advertisements

Similar presentations

Cao et al. (2000) Gene Phylogeny of Mammals a good example where molecular sequences have led to a big improvement of our understanding of evolution.

Advertisements

Computing a tree Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas.

Phylogenetic Tree A Phylogeny (Phylogenetic tree) or Evolutionary tree represents the evolutionary relationships among a set of organisms or groups of.

Bioinformatics Phylogenetic analysis and sequence alignment The concept of evolutionary tree Types of phylogenetic trees Measurements of genetic distances.

1 Dan Graur Methods of Tree Reconstruction. 2 3.

Computing a tree Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas.

Parsimony based phylogenetic trees Sushmita Roy BMI/CS 576 Sep 30 th, 2014.

Phylogenetic reconstruction

Molecular Evolution Revised 29/12/06

Tree Reconstruction.

Lecture 7 – Algorithmic Approaches Justification: Any estimate of a phylogenetic tree has a large variance. Therefore, any tree that we can demonstrate.

CENTER FOR BIOLOGICAL SEQUENCE ANALYSIS Phylogenetic Reconstruction: Distance Matrix Methods Anders Gorm Pedersen Molecular Evolution Group Center for.

. Phylogeny II : Parsimony, ML, SEMPHY. Phylogenetic Tree u Topology: bifurcating Leaves - 1…N Internal nodes N+1…2N-2 leaf branch internal node.

CISC667, F05, Lec14, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) Phylogenetic Trees (I) Maximum Parsimony.

Heuristic alignment algorithms and cost matrices

Distance Methods. Distance Estimates attempt to estimate the mean number of changes per site since 2 species (sequences) split from each other Simply.

Maximum Likelihood Flips usage of probability function A typical calculation: P(h|n,p) = C(h, n) * p h * (1-p) (n-h) The implied question: Given p of success.

Introduction to Molecular Phylogeny Starting point: a set of homologous, aligned DNA or protein sequences Result of the process: a tree describing evolutionary.

CISC667, F05, Lec16, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) Phylogenetic Trees (III) Probabilistic methods.

Tree-Building. Methods in Tree Building Phylogenetic trees can be constructed by: clustering method optimality method.

Phylogenetic trees Sushmita Roy BMI/CS 576

Phylogenetic analyses Kirsi Kostamo. The aim: To construct a visual representation (a tree) to describe the assumed evolution occurring between and among.

Phylogeny Estimation: Traditional and Bayesian Approaches Molecular Evolution, 2003

Terminology of phylogenetic trees

BINF6201/8201 Molecular phylogenetic methods

P HYLOGENETIC T REE. OVERVIEW Phylogenetic Tree Phylogeny Applications Types of phylogenetic tree Terminology Data used to build a tree Building phylogenetic.

Why Models of Sequence Evolution Matter Number of differences between each pair of taxa vs. genetic distance between those two taxa. The x-axis is a proxy.

Molecular basis of evolution. Goal – to reconstruct the evolutionary history of all organisms in the form of phylogenetic trees. Classical approach: phylogenetic.

Tree Inference Methods

1 Dan Graur Molecular Phylogenetics Molecular phylogenetic approaches: 1. distance-matrix (based on distance measures) 2. character-state.

Phylogenetic Analysis. General comments on phylogenetics Phylogenetics is the branch of biology that deals with evolutionary relatedness Uses some measure.

Molecular phylogenetics 1 Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections

Phylogenetic trees School B&I TCD Bioinformatics May 2010.

Lecture 25 - Phylogeny Based on Chapter 23 - Molecular Evolution Copyright © 2010 Pearson Education Inc.

BINF6201/8201 Molecular phylogenetic methods

Introduction to Phylogeny Cédric Notredame Centro de Regulacio Genomica Adapted from Aiden Budd’s Lecture on Phylogeny.

Bioinformatics 2011 Molecular Evolution Revised 29/12/06.

OUTLINE Phylogeny UPGMA Neighbor Joining Method Phylogeny Understanding life through time, over long periods of past time, the connections between all.

Phylogenetic Prediction Lecture II by Clarke S. Arnold March 19, 2002.

Phylogenetic Trees  Importance of phylogenetic trees  What is the phylogenetic analysis  Example of cladistics  Assumptions in cladistics  Frequently.

Building phylogenetic trees. Contents Phylogeny Phylogenetic trees How to make a phylogenetic tree from pairwise distances  UPGMA method (+ an example)

Introduction to Phylogenetics

Calculating branch lengths from distances. ABC A B C----- a b c.

How to date Xuhua Xia

Using traveling salesman problem algorithms for evolutionary tree construction Chantal Korostensky and Gaston H. Gonnet Presentation by: Ben Snider.

More statistical stuff CS 394C Feb 6, Today Review of material from Jan 31 Calculating pattern probabilities Why maximum parsimony and UPGMA are.

Phylogenetic Analysis Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics Figures from Higgs & Attwood.

Rooting Phylogenetic Trees with Non-reversible Substitution Models Von Bing Yap* and Terry Speed § *Statistics and Applied Probability, National University.

Maximum Likelihood Given competing explanations for a particular observation, which explanation should we choose? Maximum likelihood methodologies suggest.

Phylogeny Ch. 7 & 8.

Burkhard Morgenstern Institut für Mikrobiologie und Genetik Molekulare Evolution und Rekonstruktion von phylogenetischen Bäumen WS 2006/2007.

1 CAP5510 – Bioinformatics Phylogeny Tamer Kahveci CISE Department University of Florida.

Probabilistic methods for phylogenetic tree reconstruction BMI/CS 576 Colin Dewey Fall 2015.

Probabilistic Approaches to Phylogenies BMI/CS 576 Sushmita Roy Oct 2 nd, 2014.

Distance-Based Approaches to Inferring Phylogenetic Trees BMI/CS 576 Colin Dewey Fall 2010.

Distance-based methods for phylogenetic tree reconstruction Colin Dewey BMI/CS 576 Fall 2015.

Building Phylogenies. Phylogenetic (evolutionary) trees Human Gorilla Chimp Gibbon Orangutan Describe evolutionary relationships between species Cannot.

Maximum Parsimony Phenetic (distance based) methods are fast and often accurate but discard data and are not based on explicit character states at each.

Substitution Matrices and Alignment Statistics BMI/CS 776 Mark Craven February 2002.

Bioinformatics Overview

Introduction to Bioinformatics Resources for DNA Barcoding

Evolutionary genomics can now be applied beyond ‘model’ organisms

Xuhua Xia How to date Xuhua Xia

Multiple sequence alignment (msa)

Patterns in Evolution I. Phylogenetic

Phylogenetic Trees.

Why Models of Sequence Evolution Matter

Chapter 1-1 Variables and expressions

Presentation transcript:

MOLECULAR PHYLOGENETICS Four main families of molecular phylogenetic methods :  Parsimony  Distance methods  Maximum likelihood methods  Bayesian methods

MOLECULAR PHYLOGENETICS Parsimony: “The best tree is the shortest tree.” Step 1: for a given tree topology (shape), and for a given alignment site, determine what ancestral residues (at tree nodes) require the smallest total number of changes in the whole tree. Let d be this total number of changes. Step 2:  Compute d (step 1) for each alignment site.  Add d values for all alignment sites.  This gives the length L of tree. Step 3:  Compute L value (step 2) for each possible tree shape.  Retain the shortest tree(s) = the tree(s) that require the smallest number of changes = the most parsimonious tree(s).

ATGGCTAAGACGAAGACTCAGGCT T-AA-C AN EXAMPLE USING PARSIMONY ATGGCTAAGACGAAGACTCAGGCT ATGGCTAAGACGAAGACTCAGGCT ATGGCTAAGACGAAGACTCAGGCT T-G G-A 6 steps

ATGGCTAAGACGAAGACTCAGGCT T-A G-A T-G A-C G-A 5 steps AN EXAMPLE USING PARSIMONY

ATGGCTAAGACGAAGACTCAGGCT T-A G-A T-G A-C 4 steps AN EXAMPLE USING PARSIMONY

MOLECULAR PHYLOGENETICS Some properties of parsimony Several trees can be equally parsimonious (same length, the shortest of all possible lengths). The number of trees to evaluate grows extremely fast with the number of compared sequences :  The search for the shortest tree must often be restricted to a fraction of the set of all possible tree shapes (heuristic search) => there is no mathematical certainty of finding the shortest (most parsimonious) tree.

MOLECULAR PHYLOGENETICS Distance methods: Measure the total number of substitutions that occurred on both lineages since divergence from last common ancestor. Divided by sequence length. Expressed in substitutions / site ancestor sequence 1 sequence 2

MOLECULAR PHYLOGENETICS Correspondence between trees and distance matrices Correspondence between trees and distance matrices Any phylogenetic tree induces a matrix of distances between sequence pairsAny phylogenetic tree induces a matrix of distances between sequence pairs “Perfect” distance matrices correspond to a single phylogenetic tree “Perfect” distance matrices correspond to a single phylogenetic tree

human Sumatran orang Bornean orang bonobo chimp common chimp gorilla