Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

CH 11.4 & 11.5 “DNA to Polypeptide”.

SBI 4U November 14 th, What is the central dogma? 2. Where does translation occur in the cell? 3. Where does transcription occur in the cell?

RNA and Protein Synthesis

Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.

Understanding Protein Synthesis

RNA and Protein Synthesis

Cell Protein Production

10-2: RNA and 10-3: Protein Synthesis

Translation and Transcription

Protein Synthesis.

FROM GENE TO PROTEIN: TRANSCRIPTION & RNA PROCESSING Chapter 17.

From Gene to Protein. Question? u How does DNA control a cell? u By controlling Protein Synthesis. u Proteins are the link between genotype and phenotype.

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

Lesson Overview 13.1 RNA.

13.1/13.2 Protein Synthesis From DNA to Protein Protein Synthesis is the process that cells use to produce - it involves.

RNA Ribonucleic acid single stranded also made of nucleotides.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

RNA and Protein Synthesis

VII RNA and Protein Synthesis

Protein Synthesis 12-3.

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

You should be able to label these pictures Label the following: –RNA polymerase –DNA –mRNA –tRNA –5’ end –3’ end –Amino acid –Ribosome –Polypeptide chain.

What is the job of p53? What does a cell need to build p53? Or any other protein?

1 Gene expression Transcription and Translation. 2 1.Important Features: Eukaryotic cells a. DNA contains genetic template for proteins. b. DNA is found.

The initial RNA transcript is spliced into mature mRNA

From Gene To Protein Chapter 17. From Gene to Protein The “Central Dogma of Molecular Biology” is DNA  RNA  protein Meaning that our DNA codes our RNA.

DNA Function: Information Transmission. ● DNA is called the “code of life.” What does it code for? *the information (“code”) to make proteins!

RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

What is central dogma? From DNA to Protein

RNA & Protein Synthesis

Cell Protein Production. Transcription : process of mRNA formation. 1. Triggered by chem. messengers from cytoplasm which bind to DNA 2. This causes release.

Do Now: On the “Modeling DNA Transcription & Translation” handout, figure out the compimentary DNA sequence AND the mRNA sequence.

RNA & Protein Synthesis Ribose RNA. DNARNA StructureDouble Stranded Single Stranded Bases- PurinesAdenine (A) Guanine (G) Bases - Pyrimidines Cytosine.

Genes – Coding and Flanking Genes are made up of different regions: –Coding region – part that contains information for producing the protein –Flanking.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

The beginning of protein synthesis. OVERVIEW  Uses a strand of nuclear DNA to produce a single-stranded RNA molecule  Small section of DNA molecule.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.

Transcription and The Genetic Code From DNA to RNA.

RNA processing and Translation. Eukaryotic cells modify RNA after transcription (RNA processing) During RNA processing, both ends of the primary transcript.

RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

Chapter 17.  1902 – Archibald Garrod  Suggested genes dictate phenotype through enzymes of reactions ▪ Alkaptonuria – black urine ▪ Contains alkapton.

CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…

The Central Dogma of Life. replication. Protein Synthesis The information content of DNA is in the form of specific sequences of nucleotides along the.

From Genes to Proteins. Transcription in prokaryotes Simple process No nucleus; ribosomes lie close to the DNA in cytoplasm 1 st part of the mRNA attaches.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Transcription Turning DNA into RNA. Promoter Region Promoter sites: locations on DNA just before the gene Transcription factors (proteins) bind at promoter.

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

RNA and Protein Synthesis

Translation: RNA Protein

BIOLOGY NOTES GENETICS PART 7 PAGES

RNA and Protein Synthesis

RNA and Protein Synthesis

Old News TRANSCRIPTION: process that makes an _______ ___________ of DNA. RNA is ________________, and ___ is replaced by ___ (A-U; G-C) RNA___________________.

BIOLOGY NOTES GENETICS PART 7 PAGES

Transcription & Translation.

12-3 RNA and Protein Synthesis

RNA and Protein Synthesis

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

12-3 RNA and Protein Synthesis

RNA and Protein Synthesis

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

RNA and Protein Synthesis

Presentation transcript:

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given

 TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA, using bases complimentary to a DNA sequence.

 In Eukaryotes, mRNA must be further processed before being used.  Before processing, the product of transcription is called a pre-mRNA molecule. After processing it is called a mature mRNA.  Steps in post-transcriptional modification  A methyl group is added to the 5’ end of the mRNA, called a 5’ cap.  A long series of adenine bases is added to the 3’ end. This is called a poly-A tail.  Parts of the pre-mRNA molecule called introns are removed. The remaining parts, called exons, are joined together.

 Introns are “intervening sequences” which must be cut out.  Exons are “expressed sequences” which remain and are spliced together.  Remember – prokaryotes DON’T do this.

 The mRNA copy of a gene leaves the nucleus, and heads to the ribosomes to be used.  Ribosomes build proteins by following the mRNA instructions

 Once the mRNA message leaves the nucleus, a ribosome will attach to it. Ribosome mRNA

 A codon is a 3- nucleotide sequence of mRNA that codes for a single amino acid.

 tRNA molecules have an anti-codon that is complimentary to the mRNA codon.  This is how amino acids get put together in the right order

 The ribosome attaches the new A.A. to a growing polypeptide chain.

 Stop codons code for a tRNA molecule that doesn’t carry any amino acids.  The new protein is released.

 After the stop codon is reached, the ribosome lets go of the mRNA. Both will be used again.  Most proteins are modified by other enzymes before they are ready to be used by the cell.

 With few exceptions, almost every cell uses the same genetic code.  This is one of the big pieces of evidence for a universal common ancestor to all living things.

 Translation makes proteins, using the instructions in an mRNA molecule.  A codon is 3 nucleotides that code for a single amino acid.  Ribosomes build the proteins from amino acids carried by tRNA molecules.  tRNA molecules “decode” the message into protein form by matching their anti-codons with the mRNA codons.  The universal genetic code can be used to figure out the sequence of amino acids in a protein from an mRNA sequence.

 STEP 1: Transcription.  If the template DNA strand is given, the mRNA transcript will be complimentary to it.  If the coding strand is given, the mRNA transcript will be the same (except U replaces T)  STEP 2: Post-Transcriptional modification.  Remove any indicated introns from the sequence.  STEP 3: Use the Universal genetic code to translate the mRNA into amino acids. The first codon used is the first AUG (met) from the 5’ end. Stop at the first stop codon.