Stoddard Lab Activities 1.Structural biology of design work: I-MsoI cluster designs vs. individual designs (Justin Ashworth and Greg Taylor) 2.Binding specificity selections translated into cleavage selections with I-AniI (Amanda Mak: FAH / Audrey McConnell-Smith: CFTR) 3.Direct selection of cleavage activity via protein-DNA interface mutations only with I-AniI (Ryo Takeuchi: CTLMA2) 4.Structural biology and selection experiments with novel naturally occuring LD monomer, I-OnuI (Ryo Takeuchi: MAOB target)
Multiple rounds of B-cell display and binding selection shift I-AniI specificity towards CFTR target WT I-AniI Target Site CFTR Target Site -5 consistent point mutations in final selected population - Final selected I-AniI population Unselected WT I-AniI population CFTR Target WT Target
Consensus I-AniI variant sequence from binding selection specifically nicks and cleaves CFTR target WT I-AniI Target Site CFTR Target Site Initial clone from binding selection displays site-specific DNA cutting Wild-type enzyme does not cleave CFTR site Redesigned enzyme nicks and cleaves CFTR site
Redesign for the left half site of CTLMA2 WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2: AGAAGCCGTTCATCTGTCAA -10A/-7A-5C/-4C T22Y/K23G/T29CV in addition to F13Y/S111Y G33R/I55TR/V56I/S57EQN/R59S/A68R in addition to F13Y/S111Y Isolated I-AniI variant T22Y/K23G/T29CV/G33R/I55TR/V56I/S57EQN/R59S/A68R in addition to F13Y/S111Y -10A/-7A/-5C/-4C (CTLMA2L) Shuffling the amino-acid substitutions for -10A/-7A and for -5C/-4C could not accomplish cleavage of the target site with the combined 4 base mismatches.
How to recover the cleavage activity? Spatial clash between the side chains of the substituted amino-acid residues in the 2 independent selections may inhibit the binding? K94 G15 A147 E148 D16 K227 The change in the DNA bending pattern may make some residues improperly positioned in the active site? Mutated positions in the selection for -10A/-7A Mutated positions in the selection for -5C/-4C
Crystallography of a monomeric LAGLIDADG endonuclease, I-OnuI The crystals of SeMet I-OnuI/DNA complex are being grown for phasing. GST/I-OnuI I-OnuI C F EC F E Native crystal (2.35 A, P ) GST/I-OnuI I-OnuI C F E Growing! SeMet-labeled crystal
Human monoamine oxidase B (MAOB) gene includes similar sequence to I-OnuI target. MAOB is the drug target for Parkinson’s disease and some neurodegenarative diseases. X chromosome: MAOB: MAOB target: CAAAAGGTTAAATATGTGGACC |||||||| |||| ||||| I-OnuI target: TAAAAGGTTGAATAAGTGGAAA Exon 3