Xeroderma Pigmentosum

Study Guide/Outline--Mutations Mutation Mechanisms A gene may have a mutation rate of “1.4 x10 -5 ” What exactly does this number mean? (from class) What are the molecular mechanisms by which mutations arise in the DNA? What can happen during DNA replication? Recombination, chemically? What is the difference between transitions and transversions? Effects on Protein/Effects on the Organism What are the differences between a missense, nonsense, and frameshift mutation? (and how do they arise)? Why does a silent mutation not result in an amino acid change? Mutations in DNA sequence may be written as “T352C”, while mutations in amino acid sequence may be written as “Met 54 Val”. What is meant by this nomenclature? The effect of a mutation may be reversed in an organism, either a true reversion at the same nucleotide, or through second mutations. Explain the difference between a true reversion, partial reversion, and suppressor mutations (intragenic or intergenic). What is the difference between a somatic and germline mutation (including passing on mutation to offspring and what proportion of cells in the organism are mutant)?

Different mutation rates for different genes DiseaseLocus or GeneMutation Rate Achondroplasia (dominant dwarfism) FGF-R3 (fibroblast growth factor receptor 3) 0.6 – 1.4 x Duchenne Muscular Dystrophy DMD3.5 – 4.5 x Hemophilia AClotting Factor VIII3.2 – 5.7 x 10 -5

Types of Mutations Protein Changing--Deleterious or neutral (sometimes beneficial) mutations Missense--a.a.  different a.a. Sometimes neutral effect on protein if new a.a. is chemically similar to old Nonsense — a.a. codon  stop codon (truncation of protein) Insertion or deletion of nucleotide  shift in reading frame (frameshift mutation  missense then stop codon) Non protein-changing Silent mutations (non-a.a. changing)--neutral Mutations Changes in expression pattern Mutations in the promoter or regulatory regions position effect

The genetic code

Frameshift Mutations Frameshift U GC A A A UG Met A A G Lys G C G Ala C AU UU U G Leu Frameshift: insertion or deletion of base pairs, producing a stop codon downstream and shortened protein mRNAProtein Normal mRNAProtein A UG Met A A G Lys UU U Phe G G C Gly G C A Ala U U G Leu A A Gln C

Frameshift Mutations Frameshift U GC A A A UG Met A A G Lys G C G Ala C AU UU U G Leu Frameshift: insertion or deletion of base pairs, producing a stop codon downstream and shortened protein mRNAProtein Normal mRNAProtein A UG Met A A G Lys UU U Phe G G C Gly G C A Ala U U G Leu A A Gln C

(a) Position effect due to regulatory sequences (b) Position effect due to translocation to a heterochromatic chromosome Coding sequence Core promoter Regulatory sequence Gene B Coding sequence Core promoter Gene A Inversion Translocation Core promoter for gene A is moved next to regulatory sequence of gene B. Active gene Heterochromatic chromosome (more compacted) Euchromatic chromosome Shortened euchromatic chromosome Gene is now inactive. Translocated heterochromatic chromosome B A B A Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Brooker, Fig 18.2a and b Mutations causing changes in gene expression

Achondroplasia Mutation in Fibroblast Growth Factor Receptor 3 (FGFR-3) Chromosome 4p16.3 Almost all cases  Gly 380 Arg

Nonsense and Frameshift Mutations in APC gene cause Familial Adenomatous Polyposis Inner colon epithelia is covered in polyps Risk of extracolonic tumors (upper GI, desmoid, osteoma, thyroid, brain, other) Untreated polyposis leads to 100% risk of cancer Prevention—prophylactic colectomy

Gel Electrophoresis to detect truncated APC proteins in FAP families DNA transcribed to mRNA RNA translated to protein Protein run on gel Truncated protein has different mobility in gel DNA mRNA Protein Gel Normal Mutated What will the protein bands look like on the gel?

Gel Electrophoresis to detect truncated APC proteins in FAP families DNA transcribed to mRNA RNA translated to protein Protein run on gel Truncated protein has different mobility in gel DNA mRNA Protein Gel Normal Mutated Shorter mutant protein runs faster

Germ-line mutation Gametes Embryo Mature individual Mutation is found throughout the entire body. Half of the gametes carry the mutation. Somatic mutation Patch of affected area None of the gametes carry the mutation. (a) Germ-line mutation (b) Somatic cell mutation Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Figure 18.4a and b The earlier the mutation, the larger the patch

Different results of somatic vs. germline mutations

Sources of mutation Mistakes in DNA replication: –Mismatch pairing due to “wobble-like” pairing –Slippage of DNA polymerase at repeated sequences –Tri-nucleotide repeat expansion (e.g. Huntington's gene, FRAXA. See fig 18.12) Spontaneous mutations: –Depurination –De-amination –Tautomeric shift (see fig 18.10) Oxidative stress and ROS Mutagen inducers –Chemical mutagens: ethidium bromide, 5-BrdU –Ionizing radiation –UV radiation

Wobble base pairing leads to a replicated error

Insertions and Deletions may result from strand slippage Insertion in newly synthesized strand Deletion in newly synthesized strand

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display In normal individuals, trinucleotide sequences are transmitted from parent to offspring without mutation –However, in persons with TRNE disorders, the length of a trinucleotide repeat increases above a certain critical size It also becomes prone to frequent expansion This phenomenon is shown here with the trinucleotide repeat CAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 11 n =

Fig (a) Formation of a hairpin with a trinucleotide (CTG) repeat sequence One DNA strand with a trinucleotide repeat sequence One DNA template strand prior to DNA replication Trinucleotide (CTG) repeat TNRE Hairpin with CG base pairing CCT G T G CT G CT G CT G CT G TTT AAG C AG CC AAG TTCC A T A Hairpin formation C T G C T G C T G C T C T G C T G TTT AAG C AG CC AAG TTCC A T A (b) Mechanism of trinucleotide repeat expansion(c) Mechanism of trinucleotide repeat deletion DNA replication begins and goes just past the TNRE. Hairpin forms in template strand prior to DNA replication. DNA replication occurs and DNA polymerase slips over the hairpin. DNA repair occurs. DNA polymerase slips off the template strand and a hairpin forms. DNA polymerase resumes DNA replication. DNA repair occurs. OR DNA polymerase TNRE is the same length. TNRE is longer.TNRE is shorter. Expansion of tri-nucleotide repeats

Brooks, Fig Uracil HNO 2 Adenine Cytosine H H Sugar O O H N H H N H H Template strandAfter replication Hypo xanthine H N H H O O H H Cytosine Sugar NH 2 O H H Adenine H N H NH 2 Sugar N N N N N N N N N N N N N N N N

Figure 18.9a Uracil Cytosine O (a) Deamination of cytosine +NH 3 +H2OH2O O H H H NH 2 O H H Sugar Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. N N N N

Figure 18.9b Thymine O H H O CH 3 +NH 3 5-methylcytosine (b) Deamination of 5-methylcytosine +H2OH2O NH 2 O H Sugar N N N N Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

H O CH 3 Thymine Cytosine NH 2 O H H NH O H H H Keto formEnol form Sugar H OH CH 3 O Tautomeric shift Amino formImino form CommonRare (a) Tautomeric shifts that occur in the 4 bases found in DNA O H Sugar N N NN N N N N H2NH2N H Adenine Guanine O H H H2NH2N H H NH OH Sugar H H N Keto formEnol form Tautomeric shift Amino formImino form CommonRare H Sugar Tautomeric shift N N N N N N N N N N N N N N NN Figure 18.10a Common Rare Tautomeric shifts of nucleotides change the pairing properties

Figure 18.10b Cytosine (imino)Adenine (amino) H H N Sugar O H N NN H H H H H O H O H3CH3C O Thymine (enol)Guanine (keto) H HH N NN N N N NN N N N Mis–base pairing due to tautomeric shifts

(c) Tautomeric shifts and DNA replication can cause mutation. 5′3′ 5′ TA 3′ 5′ TA 3′ 5′ 3′ 5′ TA 3′ 5′ TA 3′ 5′ TG 3′ 5′ TA A thymine base undergoes a tautomeric shift prior to DNA replication. Base mismatch A second round of DNA replication occurs. DNA molecules found in 4 daughter cells Mutation CG Temporary tautomeric shift Shifted back to its normal form Figure 18.10c

Depurination produces a “ gap ” in the DNA sequence

Deamination of cytosine bases results in C  T Transition

Unequal crossing over produces insertions and deletions

5-BrdU is an unstable chemical analog of Thymine N 5-bromouracil (keto form) Adenine Sugar 5-bromouracil (enol form) Guanine Sugar (a) Base pairing of 5BU with adenine or guanine H H H O ON O Br H H H O O H H H H N N N N N N N N N N N N Figure 18.14a

Brooker, Fig Guanine Base pairs with cytosine 8-oxoguanine (8-oxoG) Base pairs with adenine H O NH 2 H ROS H H H O NH 2 H O N Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. N N N N N N N Oxidative stress and DNA damage causes G to T transversions

Ionizing radiation –Includes X-rays and gamma rays –Has short wavelength and high energy –Can penetrate deeply into biological materials –Creates chemically reactive molecules termed free radicals –Can cause Base deletions Single nicks in DNA strands Cross-linking Oxidized bases Chromosomal breaks

Nonionizing radiation –Includes UV light –Has less energy –Cannot penetrate deeply into biological molecules material –Causes the formation of cross-linked thymine dimers –Thymine dimers may cause mutations when that DNA strand is replicated –Refer to Figure

Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display Figure Ultraviolet light Thymine dimer Thymine H H H O H H O CH 3 CH 2 H H H O H H O CH 3 CH 2 – – H H H O H H O CH 3 CH 2 H H H O H H O CH 3 CH 2 – – Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. HH O OO O P N N HH O OOP N N O O HH O OOP N N HH O OOP N N O O O O O

Go over lecture outline at end of lecture