Protein synthesis mb.edu/cellbio/r ibosome.htm
DNA vs RNA ~johnc/mbi1440.ht m
osobre.com.br/ biologia/dna-e- rna.html
Types of RNA Messenger RNA (mRNA): copy of DNA
Types of RNA Transfer RNA (tRNA):
Types of RNA
Genetic code 20 a.a. But only 4 RNA bases… If 2 nucleotides, only 16 a.a. (4 2 = 16) 3 nucleotides is great 4 3 = 64
Exercices together Transcribe this DNA into mRNA: ACGGTATTACCGCTA UGCCAUAAUGGCGAU (Answer) Now translate this mRNA into a protein: AUGCAUUGUAUGGGUUAAGCG Met, His, Cys, Met, Gly (stop)
Transcription Initiation: 1) RNA polymerase binds to DNA at a promoter region 2) DNA unwounded and template strand exposed
Transcription Elongation: 1) mRNA synthesized in 5’ to 3’ using template strand 2) elongation continues and DNA already transcribed rewinds into double- helix
Transcription Termination: RNA synthesis stops; mRNA and RNA polymerase are released
Check your understanding Biology12 Textbook P. 241 # 1, 3-6, 8-11, 13 and 14
Posttranscriptional modifications In eucaryotic cells 5’ cap is added to the start. It’s a 7- methyl guanosine which protects the mRNA from digestion by nucleases and phospohotases. See p. 244 fig. 3 Poly-A tail is added by poly-A polymerase to the 3’end. It’s to protect and helps initiate translation.
Posttranscriptional modifications Introns are removed by spliceosomes.
Check your understanding Biology12 Textbook P.249 # 1-5, 7-12
Translation: Initiation
Translation: Elongation About 60 ms/peptide bond!
Translation: Termination
Animation of the whole protein synthesis:
Check your understanding Bio 12 p.254 # 1-4, 6, 7 and 9 Do Activity p
Point mutation : Substitution of one base
Point Mutation : missense and nonsense Silent mutation:
Point mutation: insertion and deletion mutation
Check your understanding Bio 12 p. 263 # 1, 6-8
Control Mechanisms genes in humans! Housekeeping genes : always needed in a cell Transcription factors turn genes on when required
4 levels of control of gene expression Transcriptional: controls which genes are transcribed or rate of transcription Posttranscriptional: controls posttranscription Translational: controls how often and how fast translation happens Posttranslational: Controls passage through membrane and rate of activation of proteins and time its remains functional.
Operon control Operon: cluster of genes under the control of one promoter and one operator in prokaryotic cells Operator: regulatory sequences of DNA to which a repressor protein binds
The lac operon
The trp operon
Check your understanding Bio12 p. 258 # 1 – 6.