Section 11.1 Summary – pages DNA REPLICATION REVIEW 1. When does DNA divide? 2. Why does it happen at this time?

What is the first step in DNA replication? Next, what is the job of the enzyme Helicase?

What is the replication fork?

1. What happens next? 2. What enzyme is responsible for this action? 3. What is the significance of the three phosphates on the free nucleotides?

LEADING STRAND VS. LAGGING STRAND

Why does the DNA always have to build from the original DNA’s 3’?

The Flow of Genetic Information. How you get from a gene to a protein. transcription translation replication protein RNA DNA DNA gets all the glory, but proteins do all the work! We’ve talked about replication, now we will focus on TRANSCRIPTION…

Transcription The process of copying a segment of DNA into RNA. This is the first step in protein synthesis.

DNA holds the instructions to make proteins, but can NOT leave the nucleus. Proteins are made outside of the nucleus on the tiny organelles called ribosomes. The DNA needs a messenger to take a copy of the instructions to the ribosomes so the proteins can be made. What’s the problem?

Section 11.2 Summary – pages Other than DNA, what is another type of nucleic acid? There are 3 types of RNA, but today we will only mostly focus on one- mRNA. Messenger RNA (mRNA) delivers a copy of DNA’s instructions from the nucleus to the ribosomes. SIDE-NOTE!

Section 11.2 Summary – pages RNA’s structure differs from DNA’s structure in three ways. # 1 RNA is single stranded—it looks like one-half of a zipper—whereas DNA is double stranded.

Section 11.2 Summary – pages The sugar in RNA is ribose; REMEMBER: DNA’s sugar is deoxyribose. # 2

Section 11.2 Summary – pages Finally, both DNA and RNA can contain four nitrogenous bases, BUT RNA does not have Thymine. Thymine is replaced by a similar base called uracil (U). Uracil forms a base pair with adenine in RNA. # 3 What do you notice instead?

Steps of Transcription 1. DNA is uncoiled by enzymes and unzips using Helicase, just as it does in DNA replication.

Steps of Transcription 2. An enzyme called RNA polymerase recognizes and binds to a DNA at a site called a “promoter”. A promoter is a base sequence in DNA that signals the start of a gene.

Steps of Transcription 3. The RNA Polymerase then moves along the DNA strand’s 3’ 5’prime direction, joining one free RNA nucleotide after another until it reaches a termination sequence.

Steps of Transcription 4. Once the termination sequence is reached, the entire ‘coding gene’ has been transcribed into an mRNA strand, and the mRNA is cut away from the DNA.

Transcription differs from DNA replication in three key respects… 1. Instead of copy the whole DNA strand, only a selected gene within the DNA is copied. 2. Instead of DNA polymerase attaching free nucleotides, it is RNA polymerase. 3. At the end of transcription there is a single, free strand of RNA nucleotides, not a double helix.

Transcription is complete at this point. The mRNA at this point is considered “pre-mRNA”. HOWEVER, the mRNA is not yet ready to leave the nucleus and deliver DNA’s message. It first needs some “finishing touches”…… called Post-Transcriptional mRNA processing.

A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P A’s Post-transcriptional processing First a cap and tail are added to the mRNA strand. –Why? The cap helps the mRNA bind to the ribosome 5 GTP cap (modified Guanine nucleotide) The tail keeps enzymes in the cytoplasm from “attacking” the mRNA strand. poly-A tail (string of Adenine nucleotides)

Remember - Eukaryotic genes have “junk”! Eukaryotic genes are not continuous –exons = the real gene expressed / coding DNA –introns = the junk, stuff you don’t need in order to build a protein. inbetween sequence eukaryotic DNA exon = protein coding (expressed) sequence intron = non-coding (in-between) sequence

mRNA splicing – Taking out the “Trash” eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Edit out the introns A “mature” mRNA strand has now been formed –It is much shorter than the original –Exons are Exported, Introns stay IN the nucleus ~10,000 bases ~1,000 bases

Splicing must be accurate No room for mistakes! –a single base added or lost affects the entire protein AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5' Spliceosome –Made of small nuclear ribosomes –recognize splice site sequence cut & paste gene

mRNA From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a aa ribosome protein translation