CHMI E.R. Gauthier, Ph.D. 1 CHMI 2227E Biochemistry I Nucleic acids: - replication

CHMI E.R. Gauthier, Ph.D.2 DNA replication The cell cycle defines a series of events required for the division of a cell into two progeny:  S phase: duplication of DNA  M phase: mitosis  Gap phases (G1 and G2): preparation for S or M; Nucleus DNA

CHMI E.R. Gauthier, Ph.D.3 DNA replication During DNA replication, a DNA molecule is copied into 2 progeny molecules following the basic Watson-Crick rules:  Complementarity of the two strands (i.e. base pairing)  Antiparallelism (i.e. strands run in opposite 5’  3’ directions); 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’ 5’AGCTAGCTGATATCGCGATCG3’ 3’TGCATCGACTATAGCGCTAGC5’

CHMI E.R. Gauthier, Ph.D.4 DNA replication Questions to answer:  1) Conservation of the parental strands?  2) Directionality of DNA synthesis?  3) Nature of the machinery for DNA synthesis?  4) Presence of proofreading?

CHMI E.R. Gauthier, Ph.D.5 Semi-conservative Conservative Dispersive Non-conservative DNA replication 1) Conservation of the parental strands In theory, DNA replication can occur through different mechanisms, depending on how the parental strands are distributed among the daughter molecules;

CHMI E.R. Gauthier, Ph.D.6 DNA replication 1) The Meselson and Stahl experiment PNAS 1958;44;

CHMI E.R. Gauthier, Ph.D.7 DNA replication 2) Directionality of replication Studies using electron microscopy revealed that the replication of bacterial DNA molecules occurs bidirectionally:  Both strands are duplicated at the same time  The site where replication occurs is called the replication fork;  The parental strand is denatured at the replication fork;  Replication starts at a specific point: the origin of replication Replication forks

CHMI E.R. Gauthier, Ph.D.8 DNA replication The replication fork 3’ Replication fork 5’ 3’ 5’ 3’ 5’ Direction of the replication fork

CHMI E.R. Gauthier, Ph.D.9 DNA replication Large DNA molecules can have multiple origins of replication

CHMI E.R. Gauthier, Ph.D.10 DNA replication 2) Directionality of replication BUT: how is replication preformed with respect to the polarity of the DNA strands? In other words, is DNA replication occuring:  From the 5’ end towards the 3’ end, OR  From the 3’ end towards the 5’ end, OR  Does it matter at all??? 5’ 3’ 5’ 3’ 5’

CHMI E.R. Gauthier, Ph.D.11 DNA replication 2) Directionality of replication In all living organisms, DNA replication is always performed in the 5’  3’ direction:  The progeny strand is elongated by the addition of new nucleotides at its 3’ end

CHMI E.R. Gauthier, Ph.D.12 DNA replication 2) Directionality: Okazaki fragments

CHMI E.R. Gauthier, Ph.D.13 DNA replication The replication fork

CHMI E.R. Gauthier, Ph.D.14 DNA replication 3) Nature of the replication machinery Requirement for DNA replication:  DNA template (i.e. the parent DNA molecule);  All 4 deoxynucleotide triphosphates (dNTPs: dATP, dGTP, dCTP, dTTP);  DNA polymerase (an enzyme)  A DNA or RNA primer to jump start DNA replication;

CHMI E.R. Gauthier, Ph.D.15 DNA replication 3) DNA polymerase

CHMI E.R. Gauthier, Ph.D.16 DNA replication 3) DNA polymerase The role of DNA polymerase is only to catalyse the formation of the phosphodiester bond. It has NOTHING to do with base pairing (well….almost nothing); Processivity: number of phosphodiester bonds synthesized by the polymerase before it loses its grip on the DNA molecule.

CHMI E.R. Gauthier, Ph.D.17 DNA replication 3) DNA polymerase

CHMI E.R. Gauthier, Ph.D.18 DNA replication 3) DNA polymerase III of E. coli

CHMI E.R. Gauthier, Ph.D.19 DNA replication 3) DNA polymerase III of E. coli (Clamp loader) (DNA polymerase)

CHMI E.R. Gauthier, Ph.D.20 DNA replication 3) DNA polymerase III of E. coli

CHMI E.R. Gauthier, Ph.D.21 DNA replication 3) DNA polymerase III of E. coli Sliding clamp Put DNA Here! Direction of replication

CHMI E.R. Gauthier, Ph.D.22 DNA replication 3) Primase DNA polymerase III can only work if there is a 3’OH available to catalyse the formation of the phosphodiester bond; In other words: before DNA pol can act, DNA synthesis must already be initiated…WHAT?? This 3’OH is provided by an RNA synthetizing enzyme called DNA primase. DNA primase synthetizes a short (10 nt) RNA primer complementary to the DNA template; DNA pol I replaces the RNA primer by DNA;

CHMI E.R. Gauthier, Ph.D.23 DNA replication Initiation at the origin of replication

CHMI E.R. Gauthier, Ph.D.24 DNA replication Leading strand synthesis Unwinds DNA

CHMI E.R. Gauthier, Ph.D.25 Occurs exactly like leading strand synthesis, with the exception that a DNA primase periodically synthesizes an RNA primer; DNA replication Lagging strand synthesis

CHMI E.R. Gauthier, Ph.D.26 DNA replication Lagging strand

CHMI E.R. Gauthier, Ph.D.27 DNA replication - DNA ligase Lacking Phosphodiester bond

CHMI E.R. Gauthier, Ph.D.28 DNA replication 4) Proofreading

CHMI E.R. Gauthier, Ph.D.29 DNA replication 4) Proofreading

CHMI E.R. Gauthier, Ph.D.30 DNA sequencing

CHMI E.R. Gauthier, Ph.D.31 PCR

CHMI E.R. Gauthier, Ph.D.32 PCR

CHMI E.R. Gauthier, Ph.D.33