Phylogeography of the Seastar Linckia laevigata and its obligate parasite Thyca crystallina Bolanle Akinronbi, Marta Muñoz, Paul Barber.

Slides:

Advertisements

Similar presentations

Rebecca E. Colman 1, Robert J. Brinkerhoff 2, Adina Doyle 1, Chris Ray 3, Paul Keim 1, Sharon K. Collinge 3, and David M. Wagner 1 1 Northern Arizona University,

Advertisements

Gene tree analyses of Aboriginal Australians Rosalind Harding University of Oxford.

Materials & Methods Collections Specimens of Themiste pyroides and Phascolosoma agassizii were collected from Peter the Great Bay (Figure 3) in the Sea.

Phylogenetics and Host Relationships of Plantbugs Inhabiting Native Cypress Pine Celia Symonds The University of Sydney and the Australian Museum Honours.

Amorphophallus titanum Largest unbranched inflorescence in the world Monecious and protogynous Carrion flower (fly/beetle pollinated) Indigenous to the.

 Aim in building a phylogenetic tree is to use a knowledge of the characters of organisms to build a tree that reflects the relationships between them.

Mitochondrial phylogeny and population pattern of Elopichthys bambusa (Richardson 1845) in Yangtze River as inferred from Cytochrome b sequences by Khalid.

Efficiency of the DNA-barcode expertise and its relationships with the practice of alpha-taxonomy illustrated by the study of the genus Eumunida (Decapoda).

Effects of the Landscape on Gene Flow and Connectivity of Boreal Toads Jennifer Moore, Julie Nielsen, David Tallmon, Sanjay Pyare University of Alaska.

Dispersal models Continuous populations Isolation-by-distance Discrete populations Stepping-stone Island model.

17 cm 6 mm. 17 cm 6 mm Kellet’s whelk, Kelletia kelletii Habitat: Rocky reef/kelp forests. Partial migration offshore during winter? Carnivorous predator.

Human Migrations Saeed Hassanpour Spring Introduction Population Genetics Co-evolution of genes with language and cultural. Human evolution: genetics,

Materials and Methods Ways to Collect Coral Larvae 1. Collect Gametes during Spawning Sites -Kapoho -Collected samples observed in lab -HIMB (Coconut Island,

DIVERSITY ON CORAL REEFS. DIVERSITY - PERSPECTIVES 1) taxonomic 2) ecological 3) genetic 4) functional.

Chapter 2 Opener How do we classify organisms?. Figure 2.1 Tracing the path of evolution to Homo sapiens from the universal ancestor of all life.

Molecular Microbial Ecology Lecture 1 Professor Ralph Kirby Faculty of Life Sciences Extension 5511 Room B322.

Biodiversity, Human Impact, and Conservation

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

- Delphine MUTHS & Jérôme BOURJEA - Connectivity of Marine Protected Areas in South-Western Indian Ocean: Using population genetics of reef fish to contribute.

Caitlyn Roan, Tara Connor, and John Grimsley. The Blenny: Ophioblennius One of the most diverse suborders of teleost fishes 723 species 127 genera 6 families.

Hotspots as focal points of conservation and ecological knowledge Feeling Hot Hot Hot? Mary O’Connor Christy Royer.

Background  The soft shell clam, Mya arenaria, currently occupies a large geographical range in the northern hemisphere.  Soft shell clams are found.

Hawaii Institute of Marine Biology – Pacific Islands Regional Sanctuary RESEARCH PARTNERSHIP OBJECTIVE: Provide scientific research that informs ecosystem-based.

Isle Royale, Michigan Grey Wolves and Genetic Drift Conservation Genetics of the Endangered Isle Royale Gray Wolf Wayne et al Conservation Biology,

FISH SPECIES IDENTIFICATION AND BIODIVERSIFICATION IN ENUGU METROPOLIS RIVER BY DNA BACODING PRESENTED BY Chioma Nwakanma (PhD) Michael Okpara University.

PHYLOGEOGRAPHY OF THE BOBWHITES Damon Williford, Randy W. DeYoung, Leonard A. Brennan, Fidel Hernández Caesar Kleberg Wildlife Research Institute Texas.

Figure 1. Map depicting the supposed evolutionary history of terrestrial leeches in North America. Shaded area represents the Appalachian Range. (●) Haemopis.

26.1 Organisms Evolve Through Genetic Change Occurring Within Populations. “Nothing in Biology makes sense except in the light of Evolution” –Theodosius.

Connectivity over ecological and evolutionary time in coral reef fishes Serge PLANES Connectivity over ecological and evolutionary time Serge Planes

MEME homework: probability of finding GAGTCA at a given position in the yeast genome, based on a background model of A = 0.3, T = 0.3, G = 0.2, C = 0.2.

Biogeography, Conservation, and Genetics Biology of Fishes

BCB 241 Estimating population size of Homo sapiens Elzonia Bezuidenhout,Biodiversity and Conservation Biology,UWC

Chapter 3: Ecological and Evolutionary Principles of Populations and communities.

Lecture 17: Phylogenetics and Phylogeography

Clonal diversity matters High levels of functional and genetic diversity occur in the model microzooplankter Oxyrrhis marina S chool of B iological S ciences.

Randy W. DeYoung, Erin M. Wehland, Damon L

Ecological Genomics of Hadal Amphipods Heather Ritchie 1, Alan J. Jamieson 2 and Stuart B. Piertney 1 1 Institute of Biological and Environmental Sciences,

Genetic Connectivity of Pelagic Fishes (Katsuwonus pelamis and Scomberomorus commerson) across the Indo-West Pacific Alexis Jackson 1, Paul Barber 2 1.

Phylogeography of Leucetta chagosensis (Porifera, Calcarea) Christoph Flucke, Jens Kurz, Rasmus Liedigk, Zdenka Valenzova Fig.4: RAxML Phylogram Fig.5:

Northern Star Coral (Astrangia poculata) Populations from the New Jersey Coast. Abstract- This project investigated the distribution and molecular evolution.

A Posteriori Tests of Phylogeographic Hypotheses Jeet Sukumaran and Allen Rodrigo Duke University.

Phylogenetics: The “E” word in disguise Keith A. Crandall, Brigham Young University

Female dispersal and gene flow Low High Male dispersal and gene flow Low High Geographic structure in… mtDNA-- yes Autosomal genes-- yes Y-linked genes--

Fecal DNA typing to determine the fine scale population structure and sex-biased dispersal pattern of Eurasian otter (Lutra lutra) in Kinmen CHUAN-CHIN.

Amorphophallus titanum

Biodiversity, Human Impact, and Conservation. Lecture 1: Biodiversity Biodiversity is the variation of lifeforms within a given ecosystem. Biodiversity.

Phylogeographic structure of Tridacna crocea across the Indo West Pacific “How diverse is your clam chowda?” Matthew Subia 1, Paul Barber 2 1 CSU Monterey.

INTRODUCTION Use of DNA data in determining phylogenetic relationships is well established. DNA barcode approach to use.

There are old asexuals in low sex/infection lakes # Asexual lineages Background All else being equal, asexual females will produce twice as many daughters.

 DNA was extracted from New England cottontail fecal pellets 1 using a QiAmp DNeasy Stool Kit (Qiagen) Genetic Structure of an Isolated New England Cottontail.

 Occupancy Model Extensions. Number of Patches or Sample Units Unknown, Single Season So far have assumed the number of sampling units in the population.

Impact of Historical Climate Change on the Genetic Structure of the Great Basin Pocket Mouse, Perognathus parvus Ashwitha Francis, Mallory E. Eckstut,

Robert Page Doctoral Student in Dr. Voss’ Lab Population Genetics.

Gene flow and speciation. Mechanism for speciation Allopatric speciation Sympatric speciation.

Science-based “rules of thumb” for the design of marine protected area networks Mark H. Carr Dept. of Ecology and Evolutionary Biology, University of.

Alyssa Kent 6/1/2013 C-MORE Student Symposium

Population Genetic Structure of Octopus vulgaris

Crystiana Tsujiura (’14) and Judy L. Stone

Introduction Conclusion References Aim of the work

Cryptic Sucker Species of the Northeast

Why study population genetic structure?

Molecular Phylogeography of the Japanese Weasel Mustela itatsi and the Siberean Weasel Mustela sibrica, revealed by complete mitochondiral DNA sequences.

DNA Marker Lecture 10 BY Ms. Shumaila Azam

Landscape Ecology in the Marine Environment

Plague: Out of the Foothills

Sopiko Kurdadze Supervisor: Professor David Tarkhnishvili

Coupling Genetic and Ecological-Niche Models to Examine How Past Population Distributions Contribute to Divergence L. Lacey Knowles, Bryan C. Carstens,

Phylogeny and the Tree of Life

Whole-chromosome view of gene density, inverse environmental variation, inverse total variation, and open chromatin signature. Whole-chromosome view of.

Presentation transcript:

Phylogeography of the Seastar Linckia laevigata and its obligate parasite Thyca crystallina Bolanle Akinronbi, Marta Muñoz, Paul Barber

What is Phylogeography? Phylogeography deals with the historical, phylogenetic components of the spatial distribution of gene lineages; so that time and space are jointly considered axes onto which gene genealogies of interest are mapped (Avise, 2000).

Linckia laevigata is a species of sea star that lives on a coral reef. Linckia laevigata

Thyca crystallina is a species of gastropod snails. They are obligate parasites of the species Linckia laevigata. Thyca crystallina

Why Study Host-Parasite Relationships?  Information obtained from phylogeographic studies of Host- Parasite relationships can be used to better understand the ecology of both host and parasite as well as provide information about effective population sizes, dispersal distances, gene flow rates and the factors that control these parameters. ( McCoy et al). Knowledge thus obtained may then be applied on a grander scale in areas such as conservation, vaccine development and disease prevention.  These studies are also important for directing future studies of cospeciation and coevolution of Host and parasite species

Previous comparative studies of Host- Parasite populations have revealed varying results. In some cases both Host and parasite show equal phylogeographic structure, in some the host had more structure while parasites were more structured in others. (McCoy et al 2005).

Coevolution Host and Parasites Hafner et al (1994)

HYPOTHESIS  Linckia disperses as larvae and so does its parasite Thyca, therefore it is expected that they will have similar patterns of phylogeography.

The aim of the study was twofold: 1. to investigate genetic relationships within Linckia and Thyca populations from different locations in the Indo-West Pacific Ocean. 2. to compare patterns of phylogeography between both Host-Parasite species

METHODS 377 individuals of the host Linckia were sampled in 25 populations from locations in the coral reefs around the Indo-West Pacific and 204 individuals of thyca were sampled from 13 populations. DNA extraction using chelex PCR Amplification of the mitochondrial gene: Cytochrome Oxidase 1 (COI) They were sequenced on a ABI 377 DNA Sequencer

ANALYSIS  Individual haplotype definitions were obtained using MacClade.  Genetic analysis was conducted using PAUP and ARLEQUIN.

LINCKIA

THYCA

LINCKIA THYCA

Amova Data Showing Variation In Linckia

Amova Data Showing Variation Across Indian Pacific

Pairwise Fst values show inverse relationship

CONCLUSION What have we found?  Thyca is not coevolving with Linckia. Rather its pattern of gene flow suggests that it may have evolved ways to disperse beyond the dispersal distances of its host, Linckia.  This may not be surprising given the difference in terrestrial vs marine methods of Host - parasite Dispersal.

It will be interesting to see in future studies how the length of larval stages in both Linckia and Thyca may have influenced the differences observed in their phylogeographic patterns.

ACKNOWLEDGEMENTS I’d like to thank Paul Barber, Marta Munoz, Elizabeth Jones and Eric Crandall for their support and contributions towards this project.