ISOLATION AND CHARACTERIZATION OF E. coli FROM THE MEAT SAMPLES By By BHAWNA SINGH BHAWNA SINGH Under the supervision of Under the supervision of Dr. Purushottam Dr. Purushottam, Sardar Vallabh Bhai Patel University of Agriculture & Technology, University of Agriculture & Technology, Modipuram Modipuram

INTRODUCTION : Meat, a rich source of protein. Meat, a rich source of protein. Today the people of all religions eat the meat without thinking about the ethical values. Today the people of all religions eat the meat without thinking about the ethical values. Demerits: Demerits: Raw meat available in open-air local retail shops without appropriate temperature control. Raw meat available in open-air local retail shops without appropriate temperature control. Changes in eating habits, mass catering, complex and lengthy food supply procedures with increased international movement and poor hygiene practices. Changes in eating habits, mass catering, complex and lengthy food supply procedures with increased international movement and poor hygiene practices.

During food processing and handling. During food processing and handling. Reason behind choosing E. coli as a research material is that its a fastidious bacteria which can grow easily in appropriate laboratory condition. Reason behind choosing E. coli as a research material is that its a fastidious bacteria which can grow easily in appropriate laboratory condition.

Objective of this study To detect the presence of virulent genes in the meat sample specifically in the Meerut zone.

Importance of this study: To aware the people what is good for the health. To aware the people what is good for the health. To know about bacterial contamination in the meat samples specifically in Meerut zone. To know about bacterial contamination in the meat samples specifically in Meerut zone. To detect the virulent genes if they were present in the meat samples. To detect the virulent genes if they were present in the meat samples. To know Antibiotic profile that will control the use of antibiotics in clinical practice. To know Antibiotic profile that will control the use of antibiotics in clinical practice.

Procedure

Sample collection

Table : Source & distribution of Meat sample S. No S. No Sample Sample Place of collection Place of collection No. of sample No. of sample A Meat Meat Jaidifarm Jaidifarm 1 B Meat Meat Kuti Kuti 1 C Meat Meat PVS road PVS road 1 D Meat Meat Tejgarhi Tejgarhi 1 E Meat Meat Hapur road Hapur road 1 F Meat Meat Golakuan Golakuan 1 G Meat Meat Jiadinagar Jiadinagar 1 H H Meat Meat Nai sarak Nai sarak 1 I Meat Meat Shastri Nagar Shastri Nagar 1 J J Meat Meat Bhumia pul shops Bhumia pul shops 1 K K Meat Meat Cantt area Cantt area 1 L Meat Meat Pallavpuram Pallavpuram 1 M M Meat Meat Garh road Garh road 1 N N Meat Meat Hind shop Hind shop 1 O Meat Meat Begum pul Begum pul 1 P P Meat Meat Abulane Abulane 1 Q Q Meat Meat Jali coti Jali coti 1 R Meat Meat Hapur hadda Hapur hadda 1 S Meat Meat Saket Saket 1 T Meat Meat Budhana gate Budhana gate 1

Enriched in peptone solution for 24 hrs at 37˚C. Enriched in peptone solution for 24 hrs at 37˚C. Streaked on Mac Conkey agar and incubated at 37˚C for 24 hrs. Streaked on Mac Conkey agar and incubated at 37˚C for 24 hrs. Pink colonies were streaked on EMB agar and incubated at 37˚C for 24 hrs. Pink colonies were streaked on EMB agar and incubated at 37˚C for 24 hrs.

Metallic green sheen colonies were observed. Metallic green sheen colonies were observed. Metallic sheen colonies streaked and stabbed on the Tsi slant and incubated overnight. Metallic sheen colonies streaked and stabbed on the Tsi slant and incubated overnight.

Isolation of E. coli on differential media: Meat sample A showing pink colour colonies on Mac Conkey agar. Control Result Control Result

Table: Meat samples A, B, E, J, R, T showing positive test on Mac Conkey agar Sample.No. Date of streak on MacConkey Agar Incubation Period Pink colour Colonies A hrs + B hrs + C hrs - D hrs - E hrs + F hrs - G hrs - H hrs - I hrs - J hrs + K hrs + L hrs - M hrs - N hrs - O hrs - P hrs + Q hrs + R hrs + S hrs - T hrs +

Isolation of E. coli on EMB agar: Meat sample A showing metallic green sheen colonies on EMB agar. Meat sample A showing metallic green sheen colonies on EMB agar. Control Result Control Result

Table: Meat sample A, B, J, K, P, R showing positive test on EMB agar S.No. S.No. Date of streak on EMB agar Incubation Period Incubation Period Green Sheen Colonies A hrs + B hrs + C hrs - D hrs - E hrs - F hrs - G hrs - H hrs - I hrs - J hrs + K hrs + L hrs - M hrs - N hrs - O hrs - P hrs + Q hrs - R hrs + S hrs - T hrs -

Morphological Characterization Gram staining: Gram staining of isolate A. Gram staining of isolate A.

Biochemical characterization Antibiotic profile test: Antibiotic and symbol Antibiotic and symbol Results Results Ciprofloxacin [ Cf ] Ciprofloxacin [ Cf ] Resistant Resistant Co-Trimazine [Cm] Co-Trimazine [Cm] Resistant Resistant Kanamycin [ K ] Kanamycin [ K ] Resistant Resistant Nitrofurantoin [Nf ] Nitrofurantoin [Nf ] Sensitive Sensitive Steptomycin [ S ] Steptomycin [ S ] Intermediate Intermediate Tetracyline [ T ] Tetracyline [ T ] Resistant Resistant Amikacin [ Ak ] Amikacin [ Ak ] Resistant Resistant Carbenicillin [ Cb ] Carbenicillin [ Cb ] Resistant Resistant

Triple sugar iron test: Test is positive for sample A, B, J, K, P, R. Test is positive for sample A, B, J, K, P, R. Control Result Control Result

E. coli Identification kit: The isolates of sample A is positive for all biochemical and carbohydrate test except citrate test. The isolates of sample A is positive for all biochemical and carbohydrate test except citrate test.

Table : Biochemical test results obtained by identification kit. S. No S. No TEST TEST RESULT RESULT A Methyl red test Methyl red test + A Voges Proskaeur ’ s test Voges Proskaeur ’ s test - A Citrate utilization test Citrate utilization test - A Indole test Indole test + A Glucorinidase test Glucorinidase test + A Nitrate reduction test Nitrate reduction test + A ONPG test ONPG test + A Lysine decarboxylase test Lysine decarboxylase test + A Lactose utilization test Lactose utilization test + A Glucose utilization test Glucose utilization test + A Sucrose utilization test Sucrose utilization test + A Sorbitol utilization test Sorbitol utilization test +

Molecular characterization of E. coli : PCR PCR was performed to detect virulent genes of VTEC by using three different primer specific to vt1, vt2 and eae gene according to Blanco et. al., (1996). Base sequence and predicted sizes of amplified product for the specific oligonucleotide primers (Genei, Bangalore) used as shown in following table. PCR was performed to detect virulent genes of VTEC by using three different primer specific to vt1, vt2 and eae gene according to Blanco et. al., (1996). Base sequence and predicted sizes of amplified product for the specific oligonucleotide primers (Genei, Bangalore) used as shown in following table.

Primers used in PCR for amplification of specific fragments for virulent genes of VTEC : GENES GENES SEQUENCE SEQUENCE PRODUCT SIZE vt1 a vt1 a CAGTTAATGTGGTGGCGAAG CAGTTAATGTGGTGGCGAAG vt1 b vt1 b CTGCTAATAGTTCTGCGCATC CTGCTAATAGTTCTGCGCATC vt2 a vt2 a CTTCGGTATCCTATTCCCGG CTTCGGTATCCTATTCCCGG vt2 b vt2 b GGATGCATCTCTGGTCATTG GGATGCATCTCTGGTCATTG eae 1 eae 1 ACGTTGCAGCATGGGTAACTC ACGTTGCAGCATGGGTAACTC eae 2 eae 2 GATCGGCAACAGTTTCACCCG GATCGGCAACAGTTTCACCCG

Master mix preparation Taq Buffer = 2.5µl x 6=15.0µl dNTPs = 2µl x 6=12.0µl Primer( i)= 2µl x 6=12.0µl Primer( ii)= 2µl x 6=12.0µl Taq poly= 0.5µl x 6=3.0µl DW = 11.0µl X 6=66.0µl

Procedure 1ml sample( enriched in peptone solution ) in eppendorf and then boil for 10 min & left for some time on ice 20µl master mix +5µl sample in eppendorf Pour in PCR tubes and kept on ice.

Run the PCR Electrophoresis No bands observed

Conclusion The meat available to the consumer contain a high E. coli contamination. The meat available to the consumer contain a high E. coli contamination. The samples taken from the area such as Jaidifarm, Kuti, Hapur Hadda are highly bacterial contaminated. The samples taken from the area such as Jaidifarm, Kuti, Hapur Hadda are highly bacterial contaminated. The area such as PVS road, Abulane, Saket, are free from bacterial contamination. The area such as PVS road, Abulane, Saket, are free from bacterial contamination. The samples are free from virulent genes which is the major cause of pathogenicity so its good for the people’s health. The samples are free from virulent genes which is the major cause of pathogenicity so its good for the people’s health.

THANK YOU