Catalyst: 3-17 What is gene therapy? How can it help people?
Genetic Diseases Medical conditions caused by an error in a person’s genetic material Some Show as Birth Defects Others do not become evident until childhood or adult life. Can be mild (color blindness) to life threatening
Gene Therapy Gene therapy refers to treating genetic disorders by correcting a defect in a gene or by providing a normal form of a gene.
This Little Light of Mine: This Little Light of Mine: Transform bacteria with a Jellyfish gene to make them glow
Aequorea victoria: Source of “glowing gene” for this experiment
Jellyfish Gene put into Other Critters
HOW DOES THIS HAPPEN???
DNA TECHNOLOGY!!!
Recognize specific base sequences in DNA Cut DNA at those recognition sites Restriction Enzymes
Recombinant DNA: combination of DNA from 2 or more sources
Put Recombinant into bacteria cells and clone them… then put them where you want them!!!
SCIENCE IN THE NEWS: Seg 7 What is manic depression? What is its connection to the human genome project? How might the discovery of a genetic cause for manic depression help patients like Kay Redfield Jamison, the woman featured in the segment? According to Francis Collins, the second scientist interviewed, why are scientists excited about the Human Genome Project?
STUDY GUIDES In Groups Work on page 64 Diagram first off Then work on the rest of that section
DNA Fingerprinting Determination of an individual’s unique collection of DNA restriction fragments
Collect Tissue Sample How to do DNA Fingerprinting The Big Picture >1000 cells RFLP / Southern blotPCR Analysis RFLP / Southern blot >20 cells
RFLP Analysis RFLP – Restriction Fragment Length Polymorphism; for related DNA molecules, a difference in DNA fragment sizes after restriction enzyme digestion –Difference results from presence of different DNA sequences –Certain regions of genome are highly variable
AGATCT Wild-type allele Mutant allele TCTAGA A single nucleotide change can make a difference AGAGCT TCTCGA Restriction site Not a restriction site
Example: Sickle-cell allele destroys an MstII site
Need to Analyze only a Small Fraction of Genome Human genome is too big to analyze: 3 x 10 9 base pairs 65,536 bp between cuts = ~46,000 bands Most regions of genome are not suitable: 99.9% of DNA sequence is same from one person to the next Solutions: Limit analysis to a few genomic regions Focus on regions which are highly variable
How to Focus on Specific Regions of Genome Need a probe: A short single stranded DNA which is complementary to the region of interest CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA A probe will base pair to the region of interest GTCATATGTGTTCATGGCATGGACCGAGTCAATATGCGGCT ::::::::::::::::::::::::::::::::::::::::: ATGGCATGGACC :::::::::::: probe
Southern Blotting
Simple Tandem Repeats (STRs)
Simple Tandem Repeats (STR’s) STR – region of DNA containing tandem copies of di-, tri- or tetranucleotide repeat units. Examples: Dinucleotide repeats: GTGTGTGTGTGT…… Trinucleotide repeats:ACGACGACGACG…… Tetranucleotide repeats:TATCTATCTATC……
More on STRs Number of repeats varies greatly between individuals STRs make up 10-15% of the mammalian genome STRs are also called “microsatellites” STRs are “junk DNA”
Regions of Chromosome Analyzed for DNA Fingerprinting Often Contain STRs ACTACT Person 1 ACTACT 100 ACT repeats EcoRI Person 2 ACTACT 400 ACT repeats EcoRI EcoRI fragment from Person 2 is 900bp longer than in Person 1
DNA Synthesis
Separate strands DNA Replication is Semi-Conservative AGTCAGAGTCAG TCAGTCTCAGTC TCAGTCTCAGTC AGTCAGAGTCAG AGTCAGAGTCAG AGTCAGTC AGTCAGTC TCAGTCTCAGTC AGTCAGAGTCAG TCAGTCTCAGTC AGTCAGAGTCAG TCAGTCTCAGTC Add correct bases
Building a Strand of DNA DNA polymerase – enzyme that synthesizes DNA DNA polymerase can only add nucleotides to the 3´ end of a strand DNA polymerase cannot build a new strand without a primer
DNA Polymerase Needs a Primer 3´5´ ss DNA + Nucleotides (dNTPs) + DNA polymerase = No DNA synthesis
DNA Polymerase Needs a Primer 3´5´ ss DNA + Nucleotides (dNTPs) + DNA polymerase = DNA synthesis 5´3´ primer
DNA Polymerase Needs a Primer 3´5´ ss DNA + Nucleotides (dNTPs) + DNA polymerase = DNA synthesis 5´ primer
Polymerase Chain Reaction (PCR)
Collect Tissue Sample How to do DNA Fingerprinting The Big Picture >1000 cells RFLP / Southern blotPCR Analysis >20 cells
PCR Purpose – Quickly make many copies of a region of a DNA molecule Method – Multiple rounds of DNA replication Components in PCR reaction – Target DNA, nucleotides, DNA polymerase, and primers Temperature cycling – DNA replication controlled by temperature…
Temperature Cycling in PCR Temperature cycling – PCR process uses a machine (thermocycler) in which PCR reaction goes through ~30 cycles of three different temperature changes: ~95ºC – Melting temperature 50-65ºC – Annealing temperature 72ºC – Extension temperature
Polymerase chain reaction (PCR) analysis 1). primers are designed to flank the region to be amplified in target DNA 2). primers are annealed to denatured DNA 3). DNA is synthesized using Taq polymerase (from Thermus aquaticus) 4). primers are annealed again and the process is repeated through cycles, geometrically amplifying the target sequence 5). DNA is analyzed by gel electrophoresis 1). 2). 3).
4).
DNA Technology CSI style
DNA Fingerprinting Determination of an individual’s unique collection of DNA restriction fragments
Collect Tissue Sample How to do DNA Fingerprinting The Big Picture >1000 cells RFLP / Southern blotPCR Analysis RFLP / Southern blot >20 cells
PCR Purpose – Quickly make many copies of a region of a DNA molecule Method – Multiple rounds of DNA replication
RFLP Analysis RFLP – Restriction Fragment Length Polymorphism RFLP – Restriction Fragment Length Polymorphism -Cut DNA fragments into different sizes w/ restriction enzyme -look for matches
DNA specimen is extracted from blood or other tissue DNA specimen is extracted from blood or other tissue Restriction enzymes cut up DNA Restriction enzymes cut up DNA DNA fragments are placed in wells made on gel DNA fragments are placed in wells made on gel Electric current is run through gel Electric current is run through gel Fragments separate by size Fragments separate by size Single chains of separated DNA fragments are blotted onto filter paper Single chains of separated DNA fragments are blotted onto filter paper Probes bind to complementary DNA fragments in the sample Probes bind to complementary DNA fragments in the sample Visible bands form on exposed photographic film Visible bands form on exposed photographic film Film is developed to reveal a DNA fingerprint Film is developed to reveal a DNA fingerprint
Fingerprint Analysis Let’s make some fingerprints!!! Let’s make some fingerprints!!!
Fingerprint Terminology ridge ending - a ridge that ends abruptly; ridge ending - a ridge that ends abruptly; bifurcation - a single ridge that divides into two ridges; bifurcation - a single ridge that divides into two ridges; lake or enclosure - a single ridge that bifurcates and reunites shortly afterwards to continue as a single ridge; lake or enclosure - a single ridge that bifurcates and reunites shortly afterwards to continue as a single ridge; short ridge, island or independent ridge - a ridge that commences, travels a short distance and then ends; short ridge, island or independent ridge - a ridge that commences, travels a short distance and then ends; dot - an independent ridge with approximately equal length and width dot - an independent ridge with approximately equal length and width spur - a bifurcation with a short ridge branching off a longer ridge spur - a bifurcation with a short ridge branching off a longer ridge crossover or bridge - a short ridge that runs between two parallel ridges. crossover or bridge - a short ridge that runs between two parallel ridges.
Draw and label these three on your thumbprint ridge ending - a ridge that ends abruptly; ridge ending - a ridge that ends abruptly; bifurcation - a single ridge that divides into two ridges; bifurcation - a single ridge that divides into two ridges; lake or enclosure - a single ridge that bifurcates and reunites shortly afterwards to continue as a single ridge; lake or enclosure - a single ridge that bifurcates and reunites shortly afterwards to continue as a single ridge;